20-HETE-producing Enzymes Are Up-regulated in Human Cancers

Materials and Methods

Cell culture. Human renal proximal tubule epithelial cells (HRPTEC), purchased from Cambrex Bio Science Inc. (Walkersville, MD, USA), were grown in renal epithelial cell basal medium (REBM) supplemented with 0.5% fetal bovine serum, 0.1% mEGF, 0.1% insulin, 0.1% hydrocortisone, 0.1% GA-1000, 0.1% epinephrine, 0.1% T3 and 0.1% transferrin (all obtained from Lonza, Walkersville, MD, USA). The cells were maintained at 37°C in a humidified incubator containing 5% CO₂.

Drugs. A stable 20-HETE agonist 5(Z),14(Z)-20-HEDE (WIT003) was synthesized by Dr. John R Falck (University of Texas Southwestern). Indomethacin (a nonselective cyclooxygenase (COX) inhibitor) was purchased from Sigma-Aldrich (St. Louis, MO, USA), arachidonic acid and NADPH were from Cayman chemicals (Ann Arbor, MI, USA), and EGF was from BD Biosciences (San Jose, CA, USA).

Real-Time PCR. TissueScan oncology survey cDNA panels were obtained from OriGene (Rockville, MD, USA) and quantitative PCR analysis was performed using iQ SYBR Green (BioRad Laboratories, Hercules, CA, USA) and Mx3000P real-time PCR system (Stratagene, Santa Clara, CA, USA). 20-HETE producing CYP450 isoform specific primer sequences were as follows: CYP4A11-F (ATGAAGTGTGCCTTCAGCCA), CYP4A11-R (AAG GCATTCCTCACACGGG), CYP4A22-F (AATGGGAAGAGCTCCTTGGC), CYP4A22-R (AAGGCATTCCTCATACAGC), CYP4F2-F (AAGCACCCAGAATACCAGGA), CYP4F2-R (TCATGCACATGGTCAGGAAG), CYP4F3-F(CTGTCGGCAGGAGGTACAAG), CYP4F3-R (CCTCAGGCTCTCCTTAATGC). PCR reactions contained 2-3 ng cDNA per well, based on normalization to β-actin and 0.1 μM final primer concentration in 25 μl. Reaction cycling parameters were as follows: 1 cycle at 95°C for 3 min, 45 cycles at 95°C for 10 s, 58°C for 45 s. The relative expression of the CYP isoforms was compared using the delta CT method.

Western-blot. The OncoPair Insta-Blot ready to use PVDF western blot membrane containing denatured protein lysates from diseased and adjacent normal tissue was obtained from Imgenex (San Diego, CA, USA). The Insta-Blot PVDF membrane was wetted with 100% methanol to rehydrate, then blocked in 5% nonfat dry milk for 1 h and incubated with an isoform-specific CYP4F2 primary antibody (HPA014048, Sigma Aldrich) overnight at 4°C. Following incubation with the primary antibodies, membranes were immunoblotted with goat anti-rabbit-HRP conjugated secondary antibody (BioRad) incubated with ECL+ (Amersham, Pittsburg, PA, USA) and exposed to film to detect chemilluminescence signal.

Immunohistochemistry. Formalin-fixed paraffin-embedded immunohistochemistry slides for adenocarcinoma of ovary (papillary serous) and normal ovary were obtained from Cytomyx (Division of Origene Technologies, Rockville, MD, USA). Slides were stained with a CYP4F2 primary antibody (dilution 1:25) and further incubated with goat anti-rabbit-HRP conjugated secondary antibody. DAB (3,3’-diaminobenzidine) was used as chromogen and sample slides were further counterstained with hematoxylin and eosin (Dako-Cytomation, Carpinteria, CA, USA).

CYP4A/F metabolism of AA in cancer tissue. Frozen human ovarian cancer and normal tissues (500 mg) were obtained from Proteogenex (Culver City, CA, USA). The frozen tissue was ground to a fine powder using a liquid nitrogen-cooled mortar (Fisher, Pittsburg, PA, USA) and homogenized in a buffer containing 250 mM sucrose, 1 mM EDTA, 1 mM KH₂PO₄, 9 mM K₂HPO₄ and 0.1 mM PMSF by a mechanical homogenizer, followed by sonication. The nuclear and mitochondrial fractions were removed by centrifugation and 1 mg/ml of the lysate was incubated for 1 h at 37°C in the presence of 100% O₂ with exogenous AA (40 μM), 1 mM NADPH and 2 μM indomethacin (to prevent metabolism of 20-HETE by COX). The reaction was stopped by acidification with formic acid to pH 3.5 and eicosanoids were extracted with ethyl acetate after being spiked with 2 ng of 20-HETE-d⁶ internal standard. The organic phase was dried under nitrogen gas. The eicosanoids were separated by HPLC on a Betabasic C₁₈ column (150×2.1 mm, 3 μM; Thermo Hypersil-Keystone, Bellefonte, PA) at a flow rate of 0.2 ml/min using an isocratic elution with 51:9:40:0.01 mixture of acetonitrile: methanol:water:acetic acid for 30 min followed by a step gradient to 68:13:19:0.01 acetonitrile: methanol:water:acetic acid for 15 min. The effluent was ionized using negative-ion electrospray and peaks eluting with a mass to charge ratio (m/z) of 319>245 (20-HETE), 319>301 (HETEs and EETs), 337>319 (DiHETEs), or 325>251 (internal standard) were monitored using an Applied Biosystems API 3000 LC–MS/MS. The area ratio of ion abundance in the peaks of interest to internal standards were compared with standard curves generated over a range from 0.2 to 10 ng for 20-HETE and from 1.0 to 10 ng for other metabolites in order to quantify the production of 20-HETE and other eicosanoids.

Active-Ras GTPase pull-down assay. HRPTEC cells were plated in 100-mm dishes and were grown in renal epithelial basal (REBM) media supplemented with growth factors up to 80% confluence. Prior to experiment, the cells were serum-starved in REBM basal medium containing no growth factors for 24 h. The cells were stimulated with 20 μM 5(Z),14(Z)-20-HEDE (WIT003); a stable 20-HETE agonist (13) and were immediately lysed in a buffer containing protease inhibitors. 900 μg protein was taken for an active Ras pull-down assay (Thermo Scientific, Logan, UT, USA). To pull-down active Ras, cell lysates were incubated with a GST fusion protein of the Ras effector protein binding domain (RBD) of Raf1, immobilized on gluthione agarose resin. Non-specific proteins were washed away, samples were eluted by 2× SDS buffer, and then separated by 4-20% SDS–PAGE, transferred to a PVDF membrane and probed for active Ras with anti-Ras antibody at 4°C overnight. Goat anti-mouse–HRP conjugated antibody (BioRad) was used as a secondary antibody and the detection was carried out with ECL+ chemiluminescent substrate, followed by exposure to X-ray film.