Abstract
Background: Oncogenic activation of EGF-signalling pathway is central to the progression of colorectal cancer. The use of mutations of the KRAS codons 12 and 13 as a selection biomarker for anti-endothelial growth factor receptor (EGFR) monoclonal antibody treatment is at present the first major step towards individualised treatment for patients with metastatic colorectal cancer. The impact of BRAF V600E mutation is not well documented. Patients and Methods: A total of 803 metastatic cancer samples from colorectal cancer patients were explored for KRAS exon 2 and BRAF exon 15 mutations. BRAF mutated samples were characterized for mismatch repair function. Results: Overall, 344 tumours were mutated, with 34 of them involving BRAF mutations (8 of microsatellite instability type). No specificity was found according to gender, age at diagnosis and tumour localisation. Conclusion: A complete analysis of KRAS, BRAF and PIK3CA status may identify approximately 10-15% additional patients who are unlikely to respond an EGFR-targeted monoclonal antibody and who may benefit from prospective and specific new biomarker-driven studies.
An increasing number of studies show that genetic markers can aid in refining prognostic information and predicting the benefit from systemic therapy. KRAS, PIK3CA and BRAF mutations are frequent in colorectal tumours and have been associated with poor prognosis (1, 2). However, these results remain controversial. Evidence has also demonstrated that KRAS mutations are potential markers for prediction because tumours with KRAS mutations are significantly associated with resistance to endothelial growth factor receptor (EGFR) antibody-based therapies (3). Recent studies have reported the same phenomenon with BRAF and PIK3CA mutations (4-8).
Two factors have limited the impact of mutation profiling for prognosis and prediction in standard care of colon cancer. Firstly, a large sample size is required to establish that a gene mutation has a significant impact for patient prediction or prognosis. Until recently, conducting such large-scale studies with the standard sequencing technologies was too time-consuming and expensive to be convenient for clinical studies. Secondly, even though the high frequency of KRAS, BRAF and PIK3CA mutations in colorectal cancer as well as that of KRAS in metastatic cases is well documented (9, 10), the involvement of BRAF and PIK3CA has been much less studied in this latter subgroup (11, 12).
When interest in a targeted event has been demonstrated in medical practice, an adequate frequency of occurrence is also required for it to be characterized systematically. This study presents the results of systematic screening of KRAS and BRAF for somatic mutations in a consecutive series of 803 metastatic colorectal cancer samples.
Patients and Methods
Patients. From June 2006 to March 2010, a consecutive series of 803 histological samples were collected from patients with metastatic colorectal cancer who had been referred to our institution for studying the KRAS mutation status before being enrolled in cetuximab-based protocols. Data on gender, age at diagnosis of the primary tumour and localisation in the large bowel were obtained from medical records.
DNA characterization. Enriched tumour zones were selected from fixed material on haematoxylin-stained sections and DNA was extracted from 3 punches per sample using the DNA QIAamp® micro-kit (Qiagen, Courtaboeuf, France).
Exon 2 of the KRAS gene (NM_033360) and exon 15 of the BRAF gene (NM_004333) were analysed by sequencing after PCR amplification using primer pairs 5'AAGGCCTGCTGAAAATG ACTG/5'CAAAGAATGGTCCTGCACCAG and 5'TCATAATGCT TGCTCTGATAGGA/5'GGCCAAAAATTTAATCAGTGG, respectively. Sequences were compared to the reference sequences using SeqScape® (Applied Biosystems, Cergy, France) software. The variants were encoded according to the Human Genome Variation Society recommendations (http://www.hgvs.org/mutnomen).
Five microsatellite loci were genotyped using the MSI Analysis System® v1.1 (Promega, Charbonnières, France). Tumours were classified as having microsatellite instability (MSI) or stability (MSS) type according to the recommendations of the International Consensus Committee (13).
Results
Sixteen DNA samples from the 803 tumours were not suitable for high quality PCR amplification. Somatic mutations were identified in the KRAS and BRAF genes in 312 and 34 samples, respectively, corresponding to 344 tumours, with two of them harbouring mutations of both genes. Eighteen different mutations were found in the KRAS gene (Figure 1). All except six mutations involved nucleotides G34, G35, G37 or G38. One mutation led to the insertion of a third Gly at codon 14 and one mutation involved codon 14 itself. All mutations of the BRAF gene except one were identical and involved the nucleotide 1799 of codon Val600. The unique variant substituted Leu by Gln at position 598. BRAF-mutated samples were characterized for their microsatellite status and eight were classified as being of MSI type. The 34 corresponding patients were aged 26 to 83 years at diagnosis of the primary cancer (mean age 65 years); 10 were diagnosed under 61 and 11 over 74 years of age. They were 16 female and 18 male patients. Tumours were located in the right part of the colon in 16 cases, in the left part in 13 cases and in the rectum in 5 cases (Table I).
Discussion
KRAS somatic mutations were found in 39.6% of a consecutive series of 787 metastatic colorectal adenocarcinomas. This observation, as the analysis was restricted to exon 1 of the KRAS gene, confirms previous reports on the KRAS mutation rate in primary tumours as well as in metastases (11, 14, 15). The systematic analysis of BRAF exon 15 allowed the identification of 34 mutations, i.e. 4.3% of tumours. It is usually reported that BRAF mutations are found in over 10% of colorectal cancer cases, with a particularly high frequency in right-sided tumours exhibiting an MSI phenotype and an absence of the MLH1 protein related to the methylation of the MLH1 gene promoter (16-18). In addition, this condition seems to affect women and/or elderly patients more often, for whom frequent DNA hypermethylation related to senescence of colonic epithelial cells has been well documented (19, 20). A low rate of BRAF mutation was found in the present series of metastatic tumours. As MSI sporadic tumours are reported to provide better prognosis than MSS cases (21), this eventuality was a posteriori explored by genotyping the five consensus poly-A loci, and eight BRAF-mutated tumours were found to exhibit an MSI phenotype. This high proportion was unexpected as several studies focusing on the MSI/MSS characterization of metastases in patients affected by sporadic colorectal cancer reported the rare presence of MSI cases being restricted to stage III tumours (22, 23). This observation is linked to possible Lynch syndrome in these 8 cases, the BRAF mutation status being able to distinguish both sporadic and inherited diseases only in the case of MLH1 alteration. Unfortunately, it was not possible to evaluate the expression level of the MMR proteins at this stage. Based on tumour location, stage and age at diagnosis, only one left-sided MSI tumour without lymph node invasion was removed at a young age, suggesting an underlying Lynch syndrome (24).
KRAS mutation spectrum in metastatic colorectal cancer. The 312 mutations found in KRAS exon 2 are plotted below the sequence profile of normal codons 12 to 14. All possible nucleotide substitutions at positions 34, 35, 37 and 38 are represented. The number of events found in the present study is shown in parentheses. Five unique rare events involving more than one nucleotide and one involving codon 14 are described at the bottom of the figure. No G to C transversion at positions 37 and 38 was observed.
Two of the 34 BRAF-mutated tumours also harboured KRAS mutation; this combination is a good predictor of the anti-EGFR response and the only one to be investigated in medical oncology. Furthermore, even if previous studies reported a similar predictive value for BRAF p.Val600Glu mutation, little is known about p.Leu598Gln. A systematic characterization of the BRAF mutation status together with that of the KRAS gene would thus give additional information in 3.9% of cases (31 of 787), compared to the 40% rate provided by the study of KRAS exon 2 alone. This proportion is comparable to that provided by a more complete analysis of the RAS gene family, including codons 61 and 146 of KRAS and NRAS. Recent studies showed that the mutation status of these two codons is able to predict the response of a combined therapy adding irinotecan to anti-EGFR (6). As the implementation of these extra analyses is not yet systematic in routine practice, it will be interesting to enter BRAF analysis in a single package of RAS-BRAF-PIK3CA analysis for therapeutic evaluation of metastatic colorectal cancer (25-27), particularly for a BRAF-targeted drug being developed.
General characteristics of BRAF mutated patients.
Acknowledgments
This work was supported by the French National Cancer Institute INCa. We would like to thank the Regional Oncology Network for referring eligible patients to the somatic genetics platform (lab#2006-gen-02). We are also grateful to all contributing pathologists who selected appropriate tissue samples for reliable molecular analyses.
- Received August 31, 2010.
- Revision received September 27, 2010.
- Accepted September 22, 2010.
- Copyright © The Author(s). Published by the International Institute of Anticancer Research.
References
In this issue
Jump to section
Related Articles
Cited By...
- No citing articles found.