Skip to main content

Main menu

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • Anticancer Research
    • In Vivo
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
  • About Us
    • General Policy
    • Contact
  • Other Publications
    • Cancer Genomics & Proteomics
    • Anticancer Research
    • In Vivo

User menu

  • Register
  • Subscribe
  • My alerts
  • Log in
  • Log out
  • My Cart

Search

  • Advanced search
Cancer Genomics & Proteomics
  • Other Publications
    • Cancer Genomics & Proteomics
    • Anticancer Research
    • In Vivo
  • Register
  • Subscribe
  • My alerts
  • Log in
  • Log out
  • My Cart
Cancer Genomics & Proteomics

Advanced Search

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • Anticancer Research
    • In Vivo
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
  • About Us
    • General Policy
    • Contact
  • Visit iiar on Facebook
  • Follow us on Linkedin
Research ArticleExperimental Studies
Open Access

LOC100506691 Is an Oncogenic Long Noncoding RNA that Promotes Growth and Motility of Lung Cancer Cells

YU-HSUAN CHEN, CHIH-YUN YANG, PEI-JUNG LIU, WAN-CHUNG HU, KUO-CHENG LU, CHING-FENG CHENG and KUO-WANG TSAI
Cancer Genomics & Proteomics September 2025, 22 (5) 775-790; DOI: https://doi.org/10.21873/cgp.20536
YU-HSUAN CHEN
1Division of Chest Medicine, Department of Internal Medicine, CHENG HSIN General Hospital, Taipei, Taiwan, R.O.C.;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
CHIH-YUN YANG
2Division of Chest Medicine, Kaohsiung Municipal Min-Sheng Hospital, Kaohsiung, Taiwan, R.O.C.;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
PEI-JUNG LIU
3Division of Chest Medicine, Department of Internal Medicine, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan, R.O.C.;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
WAN-CHUNG HU
4Department of Clinical Pathology and Medical Research, Taipei Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation, New Taipei City, Taiwan, R.O.C.;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
KUO-CHENG LU
5Department of Research, Taipei Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation, New Taipei City, Taiwan, R.O.C.;
6Division of Nephrology, Department of Medicine, Fu-Jen Catholic University Hospital, School of Medicine, Fu-Jen Catholic University, New Taipei City, Taiwan, R.O.C.;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
CHING-FENG CHENG
7School of Medicine, Tzu Chi University, Hualien, Taiwan, R.O.C.;
8Department of Pediatrics, Taipei Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation, New Taipei City, Taiwan, R.O.C.;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
KUO-WANG TSAI
9Department of Research, Taipei Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation, New Taipei City, Taiwan, R.O.C.;
10Department of Nursing, Cardinal Tien Junior College of Healthcare and Management, New Taipei City, Taiwan, R.O.C.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: kwtsai6733{at}gmail.com tch33225{at}tzuchi.com.tw
  • Article
  • Info & Metrics
  • PDF
Loading

Abstract

Background/Aim: Lung cancer is the most prevalent type of cancer and the leading cause of cancer-related mortality worldwide. Understanding the detailed mechanisms of lung carcinogenesis can improve the survival rates of patients with lung cancer. Long noncoding RNAs (lncRNAs) are large (>200 nucleotides) noncoding RNAs that play a key role in various types of human cancer by regulating the proliferation, apoptosis, and metastasis of cancer cells. LOC100506691 is an oncogene that promotes the growth and metastasis of cancer cells. However, its biological role in lung cancer remains unknown.

Materials and Methods: The expression levels and clinical significance of LOC100506691 in lung cancer were analyzed using public databases. The biological function of LOC100506691 was investigated in lung cancer cell lines following siRNA-mediated knockdown, with assessments of cell proliferation, colony formation, motility, apoptosis, and cell cycle progression. Potential signaling pathways affected by LOC100506691 knockdown were examined through western blotting and pathway enrichment analysis.

Results: According to public databases, the expression of LOC100506691 is significantly higher in lung cancer cells than in adjacent normal tissues. These high expression levels of LOC100506691 are strongly associated with poor survival outcomes in patients with lung cancer. Knockdown of LOC100506691 significantly suppresses the proliferation, colony formation ability, and metastasis of lung cancer cells. In lung cancer cells, LOC100506691 knockdown impairs the cell cycle progression and induces apoptosis by modulating the PI3K/AKT signaling pathway.

Conclusion: Our findings indicate that LOC100506691 is a novel lncRNA that promotes the growth and metastasis of lung cancer cells and therefore provide valuable insights that can aid in the development of lung cancer therapy.

Keywords:
  • LncRNA
  • lung cancer
  • LOC100506691
  • noncoding RNA
  • cell cycle

Introduction

Lung cancer is the most prevalent form of cancer and the leading cause of cancer-related deaths worldwide. Non-small-cell lung cancer (NSCLC) accounts for approximately 85% of all cases of lung cancer (1). It primarily includes two subtypes, namely lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC), each of which is characterized by unique biological markers (2). Although major advancements in NSCLC treatment have been made over the past decade, the mortality rate of patients with advanced stages of lung cancer remains excessively high (3). In addition, the 5-year relative survival rate of patients with NSCLC remains excessively low, at only 21% across all stages (4). Therefore, further research is required to identify early diagnostic markers and precise prognostic biomarkers and gain deeper insights into the pathogenic mechanisms of lung cancer, with the ultimate goal of improving the survival outcomes of these patients.

With the exception of protein-coding genes, noncoding RNAs (ncRNAs) play a key role in the development of human cancer in that they influence processes such as oncogenesis, cancer cell growth, metastasis, and drug resistance (5). Although the human genome presumably contains 15,000 to 17,000 long ncRNAs (lncRNAs), the biological function of the majority of these remains unknown (6, 7). Generally, lncRNAs are transcribed RNA molecules that contain more than 200 nucleotides. According to the literature, lncRNAs exert their function by (1) regulating protein-coding gene expression, (2) modifying epigenetic regulation, (3) modulating alternative splicing processes, and (4) titrating microRNAs (miRNAs) by serving as decoys (8).

According to previous studies, lncRNA dysfunction plays an essential role in lung carcinogenesis. These dysregulated lncRNAs can affect cancer cell growth, metastasis, drug resistance, and the tumor microenvironment (9, 10). Many lncRNAs, such as HOTAIR, H19, TRHDE-AS1, LINC01234, PVT1, DARS-AS1, PRKCA-AS1, and AFAP1-AS1, are typically dysregulated in lung cancer (9, 11-18). In a previous study, we used a microarray technique to comprehensively analyze the expression of lncRNAs in gastric cancer cells after treatment with metformin. We identified a novel oncogenic lncRNA, LOC100506691, whose expression was significantly increased in patients with gastric cancer but decreased after metformin treatment (19). LOC100506691 contributes to gastric cancer cell growth by regulating the expression of CHAC1 and miR-26a/miR-330. Its expression also significantly increases in invasive breast cancer cells (20). Despite these findings, the role of LOC100506691 and its potential effect on lung cancer progression remain unclear. Therefore, in this study, we evaluated the effects of LOC100506691 on lung cancer.

Materials and Methods

Cell culture. In this study, we used three lung cancer cell lines, namely A549, H1355, and H1299. These cell lines were obtained from the American Type Culture Collection and maintained on an RPMI 1640 medium supplemented with 10% inactivated fetal bovine serum (Invitrogen, Carlsbad, CA, USA).

Expression data. Two public databases were used to investigate the clinical effects of LOC100506691 expression on patients with lung cancer: The Cancer Genome Atlas (TCGA) and the Gene Expression database of Normal and Tumor tissues (GENT). The transcriptome expression profiles of lung cancer were downloaded from the data portal of TCGA (https://tcga-data.nci.nih.gov/tcga/dataAccessMatrix.htm). These profiles included expression data from both lung cancer tissues and adjacent normal tissues, covering 501 cases of LUSC and 535 cases of LUAD. Detailed clinical information for these patients was also obtained from TCGA. For clinical correlation analyses, including TNM staging and survival outcomes, cases with missing clinical data were excluded. As a result, 431 LUAD and 494 LUSC cases with complete clinical information were included in the survival analysis. In addition, microarray expression data for lung cancer were obtained from the GENT (http://medicalgenome.kribb.re.kr/GENT/search/search.php) that covered 1308 cases of LUAD and 931 cases of LUSC. The study protocol was approved by the Institutional Review Board of Taipei Tzu Chi Hospital (approval number: 14-IRB042).

Real-time reverse transcription PCR. Briefly, 2 μg of total RNA was subjected to reverse transcription (RT) PCR (RT-PCR) with random primers and SuperScript III Reverse Transcriptase following the manufacturer’s instructions (Invitrogen). The RT reaction involved incubation at 42°C for 1 h, followed by incubation at 85°C for 5 min to inhibit enzyme activity. Subsequently, complementary DNA was used for real-time PCR analysis with gene-specific primers. The PCR conditions were as follows: initial denaturation at 94°C for 10 min, followed by 35 cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 30 s, with a final extension step. Gene expression was quantified using a SYBR Green I assay (Applied Biosystems, Foster City, CA, USA) on an Applied Biosystems 7900HT Real-Time PCR System. The housekeeping gene GAPDH was used as an internal control. The primers were as follows: LOC100506691-F: GTCCCCAGAGATTTCAGGAAGAG, LOC 100506691-R: CCATACGCCCCTCAAACCTAA, GAPDH-F: TGCACCACCAACTGCTTAGC, GAPDH-R: GGCATGGACTGT GGTCATGAG.

Subcellular fractionation localization. The separation of nuclear and cytosolic fractions was carried out using the PARIS kit (Life Technologies, Carlsbad, CA, USA) following the manufacturer’s instructions. RNA was then extracted using TRIZOL (Invitrogen), and 2 μg of total RNA was reverse-transcribed using random primers and SuperScript III Reverse Transcriptase (Invitrogen). Finally, real-time PCR was conducted to analyze the expression levels of lncRNA. U6 served as the nuclear marker, while GAPDH was used as the cytosolic fraction marker.

RNAi knockdown of LOC100506691. Lung cancer cells, A549 and H1299, were transfected with either pooled RNAi oligonucleotides targeting LOC100506691 (siRNA#1: sense: 5-′CCAACAUAUGAUGCUAGAATT-3′ and antisense: 5′-UUCUAGCAUCAUAUGUUGGTT-3′; siRNA#2: sense: 5′-CUCUUUCUCGAGUAGUCCCTT-3′ and antisense: 5′-GGGACUACUCGAGAAAGAGTT-3′) (19) or random sequence small interfering RNA (siRNA) oligonucleotides (Invitrogen) as a negative control. The expression of LOC100506691 was verified using RT-PCR at 48 h after transfection.

Pathway enrichment analysis. Transcriptome expression data for lung adenocarcinoma (LUAD) were obtained from the TCGA data portal (https://tcga-data.nci.nih.gov/tcga/dataAccessMatrix.htm). Expression profiles from 535 LUAD tissues and 59 adjacent normal tissues were analyzed. Using Pearson correlation analysis, the top 100 genes positively and negatively correlated with LOC100506691 were identified in LUAD. These co-expressed genes were subsequently subjected to Gene Ontology (GO) and KEGG pathway analyses using DAVID Bioinformatics Resources 6.8 to identify significantly enriched pathways.

Cell cycle analysis by imaging flow cytometry. After 1×106 A549 or H1299 lung cancer cells with or without LOC100506691 knockdown were fixed with 70% ethanol for 3 h, they were stained with 4′,6-diamidino-2-phenylindole (ChemoMetec, Lillerød, Denmark) and analyzed using the NucleoView NC-3000 software (ChemoMetec). Apoptotic cells were stained with Annexin V, propidium iodide, and Hoechst 33342. To conduct an imaging flow cytometry assay, CF488A Annexin V and PI Apoptosis Kit (Biotium, Fremont, CA, USA) and Hoechst 33342 (ChemoMetec) were used to detect cells in the early and late apoptotic stages. After staining, the cells were analyzed using the NucleoCounter NC-3000 and NucleoView NC-3000 software (ChemoMetec) for automated imaging flow cytometry analysis.

Colony formation assay. A total of 4,000 A549 or H1299 cells with LOC100506691 knockdown were plated onto a six-well plate. After incubation at 37°C for 2 weeks, the cancer cell colonies were fixed with 3.7% formaldehyde for 10 min and stained with 0.2% crystal violet in 10% ethanol for 3 h. After the wells were rinsed with water, they were air-dried. To solubilize the crystal violet stain from the cells, 2 ml of 10% acetic acid was added to each well, and the absorbance (optical density) of the solution was measured using a spectrophotometer at a wavelength of 620 nm.

Cell proliferation, cell migration, and invasion assays. To conduct a cell proliferation assay, 5,000 A549 or H1299 cancer cells with LOC100506691 knockdown were plated onto a 96-well plate. Cell growth was monitored at 0, 1, 2, 3, and 4 days using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma-Aldrich, St. Louis, MO, USA). To conduct a cancer cell motility assay, A549 or H1299 cells with LOC100506691 knockdown were subjected to migration and invasion tests in vitro in a Transwell chamber (CoStar, Lowell, MA, USA). The lower or upper side of polycarbonate membranes (with pores measuring 8 μm) was coated either with 50 μg/ml type I collagen for the cell migration assay or with 80 μg/well Matrigel for the invasion assay. Cells were added to the upper portion of the Transwell chamber. After incubation for 24 h at 37°C, the cells on the lower side of the membrane were stained with Giemsa. The level of migration or invasion was determined using an optical microscope at 200× magnification. All experiments were conducted in triplicate.

Western blotting. After A549 or H1299 lung cancer cells were transfected with siLOC100506691 for 48 h, total cell lysates were extracted using radioimmunoprecipitation assay buffer (50 mM Tris-HCl at pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% deoxycholic acid, and 0.1% sodium dodecyl sulfate). Total proteins were separated from lung cancer cells by using 6-10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes (Millipore, Billerica, MA, USA). These membranes were blocked with blocking buffer (5% bovine serum albumin in Tris-buffered saline with 0.1% Tween 20) for 1 h at room temperature. Specific primary antibodies targeting certain molecules were added overnight at 4°C, followed by horseradish peroxidase–conjugated secondary antibodies for 1 h at room temperature. Specific proteins were visualized using WesternBright ECL (Advansta, San Jose, CA, USA) and detected using a BioSpectrum 500 Imaging System (UVP, USA). The following primary antibodies were used: CCNA2 (1:1,000; 18202-1-AP, Proteintech Group, Inc., Rosemont, IL, USA), CCNB1 (1:1,000; 55004-1-AP, Proteintech Group, Inc.), CCND1 (1:1,000; RM-9104-S, Thermo Fisher Scientific Inc.), CDK1 (1:200; 10762-1-AP, Proteintech Group, Inc.), CDK2 (1:1,000; MA5-17052, ThermoFisher), PI3K (1:1,000; #4292, Cell Signaling Technology, Inc., Danvers, MA, USA), AKT (1:1,000; #4691, Cell Signaling Technology, Inc.), Phospho-AKT (Thr308) (1:1,000; #4056, Cell Signaling Technology, Inc.), Bcl-2 (1:1,000; #4223, Cell Signaling Technology, Inc.), BAX (1:1,000; #5023, Cell Signaling Technology, Inc.), Bad (1:1,000; #9239, Cell Signaling Technology, Inc.), Phospho-Bad (1:1,000; #4366, Cell Signaling Technology, Inc.), and ACTB (1:2000, MAB1501, EMD Millipore).

Statistical analysis. Student’s t-tests were conducted to determine the expression levels of LOC100506691 in lung cancer cells on the basis of TCGA and GENT. Cumulative survival curves were estimated using the Kaplan–Meier method, and differences in cumulative survival probability were analyzed using a log-rank test. To analyze LOC100506691 expression across four cell lines, a one-way ANOVA was conducted to evaluate overall group differences. Pairwise comparisons between cell lines were subsequently performed using post-hoc one-way ANOVA tests with Bonferroni correction. A p-value of less than 0.05 was considered significant. Cell function assays, including measurements of cell proliferation, colony formation, cell cycle, apoptosis, invasion, and migration, were performed in triplicate. For the cell proliferation assay, repeated measures ANOVA was performed to assess the interaction between group and time. ANOVA post-hoc tests with Bonferroni correction were then used to compare pairwise differences between the two groups (N.C. vs. siLOC100506691) at each time point (day 0, 1, 2, and 3). For all other assays, comparisons between the two groups (N.C vs. siLOC100506691) were analyzed using unpaired Student’s t-tests.

Results

High expression levels of LOC100506691 associated with poor outcomes. In a previous study, we discovered that LOC100506691 was significantly overexpressed in patients with gastric cancer, resulting in poor survival outcomes (19). However, the clinical effects of LOC100506691 expression on patients with cancer remain unknown. In this study, we used the public database GENT to determine the expression levels of LOC100506691 in various types of human cancer. As presented in Figure 1A, the expression levels of LOC100506691 were significantly increased in patients with adrenal gland, blood, brain, colon, head and neck, kidney, lung, prostate, skin, and uterine cancer. However, they were significantly decreased in patients with breast, endometrial, and pancreatic cancer. Among the cancers showing high LOC100506691 expression, lung cancer has high prevalence and mortality worldwide; therefore, we selected it for further analysis.

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

Expression levels of LOC100506691 in lung cancer, obtained from TCGA or GENT. (A) Expression levels of LOC100506691 in multiple types of human cancer, obtained from GENT. (B, C) Expression levels of LOC100506691 in LUSC and LUAD, obtained from TCGA. (D, E) Kaplan–Meier survival plots of the effect of LOC100506691 expression on OS in LUAD and LUSC, obtained from TCGA. *p<0.05, **p<0.01 and ***p<0.001 using the unpaired Student’s t-test.

Using TCGA, we confirmed the expression levels of LOC100506691 and its clinical prognostic value in patients with lung cancer. As indicated in Figure 1B and C, the expression levels of LOC100506691 were significantly higher in LUAD tissues than in adjacent normal tissues, with no significant difference observed in LUSC. We also investigated the correlation between the expression of LOC100506691 and clinical pathological features, but we observed no significant correlation in either LUAD or LUSC (Supplementary Table I and Supplementary Table II). Further analysis of TCGA revealed that higher expression levels of LOC100506691 were significantly associated with shorter overall survival (OS) in patients with LUAD (p= 0.012), as evidenced by Kaplan–Meier survival curves (Figure 1D). However, we observed no significant correlation in patients with LUSC (Figure 1E). Multivariate Cox regression analysis revealed that the expression of LOC100506691 was independently associated with poor OS [adjusted hazard ratio=1.71, 95% confidence interval (CI)=1.19-2.46, p=0.004] in patients with LUAD (Table I), whereas in patients with LUSC, no significant association was observed (AHR=1.2, 95% CI=0.91-1.58, p=0.186, Supplementary Table III).

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table I.

Univariate and multivariate Cox’s regression analysis of gene expression for overall survival of 431 patients with lung adenocarcinoma.

Further analysis of the GENT revealed similar results, indicating that higher expression levels of LOC100506691 were significantly associated with shorter OS in patients with lung cancer (p<0.001), particularly in those with LUAD (p=0.0076, Supplementary Figure 1A-C). High expression levels of LOC100506691 were also significantly associated with progression-free survival (PFS) in patients with lung cancer (p=0.0062), particularly in those with LUAD (p=0.023, Supplementary Figure 1D, E). However, no significant association was observed between the expression of LOC100506691 and PFS in patients with LUSC (p=0.1, Supplementary Figure 1F). In summary, LOC100506691 may have an oncogenic function in patients with lung cancer, particularly in those with LUAD.

Role of LOC100506691 in lung cancer cell growth. According to our previous findings, LOC100506691 may play an oncogenic role in the growth and metastasis of cancer cells in patients with LUAD. In this study, we examined the expression levels of LOC100506691 in lung cancer cells by using real-time PCR. As indicated in Figure 2A, the expression levels of LOC100506691 were higher in A549 and H1299 cells, compared to HEL299 cells. We also investigated the subcellular localization of LOC100506691 and found that its expression was predominantly localized in the nuclear of lung cancer cells (Supplementary Figure 2). Based on its nuclear localization, we speculate that LOC100506691 may regulate lung cancer cell growth through mechanisms commonly associated with nuclear lncRNAs, such as modulating transcriptional activity, influencing chromatin structure, or recruiting chromatin-modifying complexes. Although direct evidence is lacking in this study, these functional roles are supported by prior research on nuclear-localized lncRNAs (21).

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Expression levels of LOC100506691 in lung cancer, determined using real-time PCR. (A) Expression levels of LOC100506691 in four lung cancer cell lines (A549, H1299, and H1355) and one human fetal lung fibroblast cell line (HEL299), determined using real-time PCR. One-way ANOVA revealed a statistically significant difference among the four cell lines (p<0.0001). One-way ANOVA post-hoc test with Bonferroni correction further revealed that all pairwise comparisons were statistically significant (***p<0.001) except for A549 and HEL299. (B) Expression levels of LOC100506691 in A549 cells, determined using real-time PCR after siLOC100506691 transfection for 48 h. (C) Expression levels of LOC100506691 in H1299 cells, determined using real-time PCR after siLOC100506691 transfection for 48 h. ***p<0.001 using the unpaired Student’s t-test.

After siLOC100506691 transfection for 24 h, the expression levels of LOC100506691 significantly decreased in A549 and H1299 cells (Figure 2B, C). Analysis of the biological function of H1299 and A549 cells with LOC100506691 knockdown revealed that LOC100506691 knockdown presumably inhibited the proliferation (Figure 3A, B) and colony formation ability (Figure 3C-E) of A549 and H1299 lung cancer cells. In addition, LOC100506691 knockdown significantly inhibited the migration and invasion capabilities of A549 and H1299 cells (Figure 4A-F).

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

LOC100506691-knockdown suppresses lung cancer cell growth. (A, B) Proliferation capacity of A549 and H1299 cells with LOC100506691 knockdown. Statistical significance between N.C and siLOC100506691 groups at each time point was assessed using one-way ANOVA post-hoc test with Bonferroni correction. *p<0.05, **p<0.01, and ***p<0.001 indicate significant differences compared to N.C at the corresponding time points. (C, D) Colony formation ability of A549 and H1299 cells with LOC100506691 knockdown. (E) Colony formation ability of A549 cells. (F) Colony formation ability of H1299 cells. ***p<0.001 using the unpaired Student’s t-test.

Figure 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 4.

LOC100506691-knockdown suppresses lung cancer cell motility. (A, B) Migration and invasion capabilities of A549 cells with LOC100506691 knockdown. (C-F) Migration and invasion capabilities of H1299 cells with LOC100506691 knockdown. ***p<0.001 using the unpaired Student’s t-test.

LOC100506691 knockdown suppresses lung cancer growth by impairing cell cycle progression. To investigate the potential role of LOC100506691 in lung cancer, we identified a set of genes positively and negatively co-expressed with LOC100506691. RNA transcriptome data from lung cancer patients were obtained from the TCGA database. Using Pearson correlation analysis, we identified candidate protein-coding genes in LUAD that were co-expressed with LOC100506691. These genes were subsequently analyzed using DAVID Bioinformatics Resources 6.8 for pathway enrichment. Gene ontology (GO) analysis revealed that LOC100506691 and its co-expressed genes were significantly enriched in the following cellular components (CC): spindle, Ctf18 RFC-like complex, vesicle, nucleoplasm, cytosol, and condensed chromosome centromeric region. The enriched biological processes (BP) were the following: cellular response to stimulus, DNA replication, establishment of organelle localization, cell division, and chromosome organization, while the enriched molecular functions (MF) were: DNA clamp loader activity and protein binding (Supplementary Figure 3A). KEGG analysis indicated that LOC100506691 might play a role in pathways such as progesterone-mediated oocyte maturation, the cell cycle, and oocyte meiosis (Supplementary Figure 3B). These results suggest that LOC100506691-regulated genes are critical for genomic stability, cell cycle progression, and reproductive system processes. Their enrichment in cellular components, biological processes, and molecular functions highlights their involvement in fundamental cellular mechanisms. Furthermore, the association with key pathways underscores the potential role of LOC100506691 in modulating cancer cell growth through cell cycle regulation.

According to the above findings, we examined the effects of LOC100506691 knockdown on the cell cycle and apoptosis by using an imaging flow technique. As presented in Figure 5A and B, LOC100506691 knockdown significantly increased the G0/G1 (67.1% vs. 72.8%, p<0.01) and sub-G1 phase population (0.4% vs. 7.7%, p<0.5) but reduced the S phase (16.3% vs. 7.6%, p<0.01) and G2/M phase (15.4% vs. 11.2%, p<0.01) populations. Further analysis of cell apoptosis through an Annexin staining assay revealed that LOC100506691 knockdown significantly induced A549 cell apoptosis (2.8% vs. 20.1%, Figure 5C and D). In A549 cells with LOC100506691 knockdown, the expression levels of cyclin A2, cyclin B1, cyclin D1, CDK1, and CDK4 were significantly decreased (Figure 5E). Analysis of apoptosis-related proteins revealed that Bad, p-Bad and Bax were significantly increased in A549 cells with LOC100506691 knockdown (Figure 5E). In addition, the expression levels of p-AKT were significantly decreased (Figure 5E). In summary, LOC100506691 knockdown suppresses the growth of lung cancer cells by impairing cell cycle progression and inducing apoptosis through PI3K/AKT signaling pathway silencing in lung cancer.

Figure 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 5.

LOC100506691 knockdown leads to impaired cell cycle progression and induction of lung cancer cell apoptosis. (A) A549 cell cycle progression after siLOC100506691 transfection for 48 h. (B) Relative quantification of A549 cells with LOC100506691 knockdown. (C) Apoptotic A549 cells evaluated using an Annexin V assay after siLOC100506691 transfection for 48 h. (D) Relative quantification of apoptotic A549 cells with LOC100506691 knockdown. (E) Expression levels of cell cycle-, apoptosis- and PI3K/AKT-related proteins, determined using Western blotting in A549 cells with LOC100506691 knockdown for 48 h. *p<0.05 and **p<0.01 using the unpaired Student’s t-test.

Discussion

Few studies have investigated the role of LOC100506691 in human cancer. In gastric cancer, LOC100506691 plays an oncogenic role in the regulation of cell growth and metastasis (19). However, its role in lung cancer remains unclear. To the best of our knowledge, this is the first study to report that high expression levels of LOC100506691 are significantly associated with poor survival outcomes in patients with LUAD. Our findings indicate that LOC100506691 plays an oncogenic role in lung cancer. Its knockdown suppresses the growth of lung cancer cells by both inducing cell cycle arrest at the G0/G1 phase and reducing S and G2/M phase populations.

In a previous study, we discovered that LOC100506691 knockdown suppresses the growth of gastric cancer cells by inducing cell cycle arrest at the G2/M phase (19). Although LOC100506691 knockdown effectively suppresses cancer cell growth by disrupting cell cycle progression, the arrested phase differs between gastric cancer and lung cancer. This discrepancy may be attributed to cancer type-specific differences, including distinct regulatory networks, variations in cyclin/CDK dependencies, and the p53 status of the cells. Notably, A549 lung cancer cells harbor wild-type TP53, and LOC100506691 knockdown in these cells led to upregulation of both p53 and its downstream effector p21, consistent with a p53-dependent G1 phase arrest. In contrast, the gastric cancer cell line used in our earlier study may exhibit altered or less active p53 signaling, which could shift the impact of LOC100506691 knockdown toward G2/M phase regulation. These observations suggest that LOC100506691 may modulate the cell cycle through distinct mechanisms depending on the cellular context. Further investigation is needed to elucidate the cell type-specific interactors and signaling pathways involved.

In patients with lung cancer, the mechanism underlying the overexpression of LOC100506691 remains unknown. In a previous study, we discovered that metformin can significantly suppress the expression of LOC100506691 in patients with gastric cancer (19). Metformin is a drug that is capable of suppressing human cancer cell growth and metastasis by activating the PI3K/AKT, AMPK, mTOR, and Wnt signaling pathways (22, 23). According to a previous study, restoring the expression levels of miR-203 may inhibit metastasis in human breast cancer by modulating the Wnt signaling pathway (24). Analysis of the Gene Expression Omnibus (GEO) database revealed that the expression of LOC100506691 significantly decreases in breast cancer cells with miR-203 overexpression (24). In lung cancer, miR-203 functions as a tumor suppressor by inhibiting cell growth and metastasis, and its overexpression induces lung cancer cell apoptosis (25-27). These findings suggest that the LOC100506691/miR-203 axis contributes to the progression of lung cancer. As indicated by the GEO database, LMO4 is an oncogene that may be involved in the regulation of LOC100506691 expression in human cancer. Its expression may induce LOC100506691 in breast cancer cell models (28). According to Wang et al. (29), the expression levels of LMO4 increase in lung cancer, and these high expression levels are associated with poor survival outcomes. Biological function assays revealed that expression of LMO4 promotes migration and invasion of NSCLC cells through the AKT/PI3K pathway (29, 30). Thus, LMO4 overexpression may induce LOC100506691 overexpression in lung cancer. Further research is required to confirm these hypotheses.

Although we did not elucidate the detailed mechanism underlying LOC100506691-regulated lung cancer cell growth and metastasis, we proposed potential mechanisms based on the literature. In addition, we investigated the biological function of LOC100506691 in lung cancer and discovered that it may be involved in the growth and metastasis of lung cancer cells by modulating the PI3K/AKT signaling pathway. The PI3K/AKT signaling pathway, a prototypical survival pathway, plays a critical role in promoting proliferation, survival, and drug resistance in various cancer types (31-33). Consequently, the development of PI3K inhibitors has shown potential benefits for patients, and these inhibitors have been evaluated in clinical trials for the treatment of lung cancer (34). However, their impact on patient survival rates has been suboptimal, and in some cases, PI3K inhibitors have been found to promote tumor cell metastasis (34). In this study, we demonstrated that LOC100506691 knockdown inhibited the activation of the PI3K/AKT pathway and downregulated the expression of cell cycle-related genes in A549 cells. This suppression resulted in reduced lung cancer cell growth by impairing cell cycle progression and inducing apoptosis. These findings suggest that targeting both LOC100506691 and the PI3K/AKT pathway may have a complementary effect in suppressing tumor progression.

Nevertheless, we did not further investigate the role of LOC100506691-regulated downstream genes in lung cancer. In a previous study, Tseng et al. (19) reported that LITAF, CHAC1, and EFEMP1 presumably play a key role in LOC100506691-regulated cancer cell growth and motility. According to Huang et al. (35), LITAF is involved in metformin-suppressed growth and migration of gastric cancer cells. LITAF is a tumor suppressor gene that inhibits tumor growth and metastasis (11, 36-38). We have previously shown that LITAF functions as an oncogene by promoting gastric cancer cell growth and motility (39). Overall, the expression of LOC100506691 is presumably associated with poor survival outcomes, and its involvement in lung cancer cell growth and motility may occur through modulation of LITAF expression. EFEMP1 is an extracellular matrix glycoprotein secreted by metastatic cancer cells. Inhibiting the expression of EFEMP1 can prevent lung cancer metastasis (40). Generally, the expression of EFEMP1 contributes to muscle-invasive bladder cancer, and its knockdown may reduce the incidence of muscle-invasive bladder cancer by regulating the levels of insulin-like growth factor-binding protein-5 in orthotopic mouse models (41). CHAC1 is a tumor suppressor gene involved in intracellular glutathione depletion, ferroptosis, and tumorigenesis. According to a previous study (42), CHAC1 overexpression promotes ferroptosis and enhanced radiation sensitivity in thyroid carcinoma. CHAC1 also modulates gastric cancer cell growth and metastasis (43). He et al. (44) argued that CHAC1 inhibits the growth of prostate cancer cells and increases their sensitivity to docetaxel. In summary, LOC100506691 may promote lung cancer cell growth and metastasis by modulating the downstream genes LITAF, EFEMP1, and CHAC1. However, the biological functions of LITAF, EFEMP1, and CHAC1 in lung cancer remain unclear. Further research is required to confirm the hypotheses proposed in this study.

Conclusion

In summary, LOC100506691 expression may play a key role in the prognosis of lung cancer. To the best of our knowledge, this is the first study to elucidate the oncogenic function of LOC100506691 in lung cancer cell growth and metastasis by impairing cell cycle progression. Overall, our findings provide valuable insights into the potential of LOC100506691 as a prognostic biomarker or therapeutic target for patients with lung cancer.

Acknowledgements

The authors thank the Biobank and Core Laboratory of the Research Department in Taipei Tzu Chi Hospital and Buddhist Tzu Chi Medical Foundation for their technical support and for providing access to their facilities.

Footnotes

  • Supplementary Material

    Supplementary data can be accessed via Figshare at the following URL: https://doi.org/10.6084/m9.figshare.29431193

  • Conflicts of Interest

    The Authors declare no conflicts of interest.

  • Authors’ Contributions

    YHC and CYY completed the study and drafted the manuscript. PJL examined the expression and clinical effects of LOC100506691 in cancer through public database analysis. WCH, KCL and CFC assisted in editing the manuscript. KWT supervised the study and edited the manuscript.

  • Funding

    This work was supported by National Science and Technology Council (113-2314-B-303-014), Taipei Tzu Chi Hospital and Buddhist Tzu Chi Medical Foundation (TCRD-TPE-MOST-111-15 and TCMF-CM3-112-03) and through collaboration between Tzu Chi Hospital and Academia Sinica (TCAS-112-02).

  • Artificial Intelligence (AI) Disclosure

    No artificial intelligence (AI) tools, including large language models or machine learning software, were used in the preparation, analysis, or presentation of this manuscript.

  • Received May 16, 2025.
  • Revision received June 29, 2025.
  • Accepted July 8, 2025.
  • Copyright © 2025 The Author(s). Published by the International Institute of Anticancer Research.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).

References

  1. ↵
    1. Filho AM,
    2. Laversanne M,
    3. Ferlay J,
    4. Colombet M,
    5. Piñeros M,
    6. Znaor A,
    7. Parkin DM,
    8. Soerjomataram I,
    9. Bray F
    : The GLOBOCAN 2022 cancer estimates: Data sources, methods, and a snapshot of the cancer burden worldwide. Int J Cancer 156(7): 1336-1346, 2025. DOI: 10.1002/ijc.35278
    OpenUrlCrossRef
  2. ↵
    1. Campbell JD,
    2. Alexandrov A,
    3. Kim J,
    4. Wala J,
    5. Berger AH,
    6. Pedamallu CS,
    7. Shukla SA,
    8. Guo G,
    9. Brooks AN,
    10. Murray BA,
    11. Imielinski M,
    12. Hu X,
    13. Ling S,
    14. Akbani R,
    15. Rosenberg M,
    16. Cibulskis C,
    17. Ramachandran A,
    18. Collisson EA,
    19. Kwiatkowski DJ,
    20. Lawrence MS,
    21. Weinstein JN,
    22. Verhaak RG,
    23. Wu CJ,
    24. Hammerman PS,
    25. Cherniack AD,
    26. Getz G, Cancer Genome Atlas Research Network,
    27. Artyomov MN,
    28. Schreiber R,
    29. Govindan R,
    30. Meyerson M
    : Distinct patterns of somatic genome alterations in lung adenocarcinomas and squamous cell carcinomas. Nat Genet 48(6): 607-616, 2016. DOI: 10.1038/ng.3564
    OpenUrlCrossRefPubMed
  3. ↵
    1. Socinski MA,
    2. Crowell R,
    3. Hensing TE,
    4. Langer CJ,
    5. Lilenbaum R,
    6. Sandler AB,
    7. Morris D, American College of Chest Physicians
    : Treatment of non-small cell lung cancer, stage IV: ACCP evidence-based clinical practice guidelines (2nd edition). Chest 132(3 Suppl): 277S-289S, 2007. DOI: 10.1378/chest.07-1381
    OpenUrlCrossRefPubMed
  4. ↵
    1. Siegel RL,
    2. Miller KD,
    3. Fuchs HE,
    4. Jemal A
    : Cancer Statistics, 2021. CA Cancer J Clin 71(1): 7-33, 2021. DOI: 10.3322/caac.21654
    OpenUrlCrossRefPubMed
  5. ↵
    1. Pan HW,
    2. Li SC,
    3. Tsai KW
    : MicroRNA dysregulation in gastric cancer. Curr Pharm Des 19(7): 1273-1284, 2013. DOI: 10.2174/138161213804805621
    OpenUrlCrossRefPubMed
  6. ↵
    1. Amaral PP,
    2. Clark MB,
    3. Gascoigne DK,
    4. Dinger ME,
    5. Mattick JS
    : lncRNAdb: a reference database for long noncoding RNAs. Nucleic Acids Res 39(Database issue): D146-D151, 2011. DOI: 10.1093/nar/gkq1138
    OpenUrlCrossRefPubMed
  7. ↵
    1. Carninci P,
    2. Hayashizaki Y
    : Noncoding RNA transcription beyond annotated genes. Curr Opin Genet Dev 17(2): 139-144, 2007. DOI: 10.1016/j.gde.2007.02.008
    OpenUrlCrossRefPubMed
  8. ↵
    1. Spizzo R,
    2. Almeida MI,
    3. Colombatti A,
    4. Calin GA
    : Long non-coding RNAs and cancer: a new frontier of translational research? Oncogene 31(43): 4577-4587, 2012. DOI: 10.1038/onc.2011.621
    OpenUrlCrossRefPubMed
  9. ↵
    1. Lin S,
    2. He C,
    3. Song L,
    4. Sun L,
    5. Zhao R,
    6. Min W,
    7. Zhao Y
    : Exosomal lncCRLA is predictive for the evolvement and development of lung adenocarcinoma. Cancer Lett 582: 216588, 2024. DOI: 10.1016/j.canlet.2023.216588
    OpenUrlCrossRefPubMed
  10. ↵
    1. Gilyazova I,
    2. Gimalova G,
    3. Nizamova A,
    4. Galimova E,
    5. Ishbulatova E,
    6. Pavlov V,
    7. Khusnutdinova E
    : Non-coding RNAs as key regulators in lung cancer. Int J Mol Sci 25(1): 560, 2023. DOI: 10.3390/ijms25010560
    OpenUrlCrossRefPubMed
  11. ↵
    1. Huang C,
    2. Chen D,
    3. Zhu H,
    4. Lv S,
    5. Li Q,
    6. Li G
    : LITAF enhances radiosensitivity of human glioma cells via the FoxO1 pathway. Cell Mol Neurobiol 39(6): 871-882, 2019. DOI: 10.1007/s10571-019-00686-4
    OpenUrlCrossRefPubMed
    1. Ren J,
    2. Fu J,
    3. Ma T,
    4. Yan B,
    5. Gao R,
    6. An Z,
    7. Wang D
    : LncRNA H19-elevated LIN28B promotes lung cancer progression through sequestering miR-196b. Cell Cycle 17(11): 1372-1380, 2018. DOI: 10.1080/15384101.2018.1482137
    OpenUrlCrossRefPubMed
    1. Zhuan B,
    2. Lu Y,
    3. Chen Q,
    4. Zhao X,
    5. Li P,
    6. Yuan Q,
    7. Yang Z
    : Overexpression of the long noncoding RNA TRHDE-AS1 inhibits the progression of lung cancer via the miRNA-103/KLF4 axis. J Cell Biochem 120(10): 17616-17624, 2019. DOI: 10.1002/jcb.29029
    OpenUrlCrossRefPubMed
    1. Xie JJ,
    2. Guo QY,
    3. Jin JY,
    4. Jin D
    : SP1-mediated overexpression of lncRNA LINC01234 as a ceRNA facilitates non-small-cell lung cancer progression via regulating OTUB1. J Cell Physiol 234(12): 22845-22856, 2019. DOI: 10.1002/jcp.28848
    OpenUrlCrossRefPubMed
    1. Yu S,
    2. Yang D,
    3. Ye Y,
    4. Liu P,
    5. Chen Z,
    6. Lei T,
    7. Pu J,
    8. Liu L,
    9. Wang Z
    : Long noncoding RNA actin filament-associated protein 1 antisense RNA 1 promotes malignant phenotype through binding with lysine-specific demethylase 1 and repressing HMG box-containing protein 1 in non-small-cell lung cancer. Cancer Sci 110(7): 2211-2225, 2019. DOI: 10.1111/cas.14039
    OpenUrlCrossRefPubMed
    1. Li J,
    2. Li Y,
    3. Sun X,
    4. Wei L,
    5. Guan J,
    6. Fu L,
    7. Du J,
    8. Zhang X,
    9. Cheng M,
    10. Ma H,
    11. Jiang S,
    12. Zheng Q,
    13. Wang L
    : Silencing lncRNA-DARS-AS1 suppresses nonsmall cell lung cancer progression by stimulating miR-302a-3p to inhibit ACAT1 expression. Mol Carcinog 63(4): 757-771, 2024. DOI: 10.1002/mc.23686
    OpenUrlCrossRefPubMed
    1. Wu C,
    2. Yang J,
    3. Lin X,
    4. Wu J,
    5. Yang C,
    6. Chen S
    : LncRNA PRKCA-AS1 promotes LUAD progression and function as a ceRNA to regulate S100A16 by sponging miR-508-5p. J Cancer 15(6): 1718-1730, 2024. DOI: 10.7150/jca.91184
    OpenUrlCrossRefPubMed
  12. ↵
    1. Endo I,
    2. Amatya VJ,
    3. Kushitani K,
    4. Nakagiri T,
    5. Aoe K,
    6. Takeshima Y
    : Long non-coding RNALINC00152 requires EZH2 to promote mesothelioma cell proliferation, migration, and invasion. Anticancer Res 43(12): 5367-5376, 2023. DOI: 10.21873/anticanres.16740
    OpenUrlAbstract/FREE Full Text
  13. ↵
    1. Tseng HH,
    2. Chen YZ,
    3. Chou NH,
    4. Chen YC,
    5. Wu CC,
    6. Liu LF,
    7. Yang YF,
    8. Yeh CY,
    9. Kung ML,
    10. Tu YT,
    11. Tsai KW
    : Metformin inhibits gastric cancer cell proliferation by regulation of a novel Loc100506691-CHAC1 axis. Mol Ther Oncolytics 22: 180-194, 2021. DOI: 10.1016/j.omto.2021.08.006
    OpenUrlCrossRefPubMed
  14. ↵
    1. Tsai KW,
    2. Chong KH,
    3. Li CH,
    4. Tu YT,
    5. Chen YR,
    6. Lee MC,
    7. Chan SH,
    8. Wang LH,
    9. Chang YJ
    : LOC550643, a long non-coding RNA, acts as novel oncogene in regulating breast cancer growth and metastasis. Front Cell Dev Biol 9: 695632, 2021. DOI: 10.3389/fcell.2021.695632
    OpenUrlCrossRefPubMed
  15. ↵
    1. Rinn JL,
    2. Chang HY
    : Genome regulation by long noncoding RNAs. Annu Rev Biochem 81: 145-166, 2012. DOI: 10.1146/annurev-biochem-051410-092902
    OpenUrlCrossRefPubMed
  16. ↵
    1. Pulito C,
    2. Sanli T,
    3. Rana P,
    4. Muti P,
    5. Blandino G,
    6. Strano S
    : Metformin: on ongoing journey across diabetes, cancer therapy and prevention. Metabolites 3(4): 1051-1075, 2013. DOI: 10.3390/metabo3041051
    OpenUrlCrossRefPubMed
  17. ↵
    1. Courtois S,
    2. Lehours P,
    3. Bessède E
    : The therapeutic potential of metformin in gastric cancer. Gastric Cancer 22(4): 653-662, 2019. DOI: 10.1007/s10120-019-00952-w
    OpenUrlCrossRefPubMed
  18. ↵
    1. Taube JH,
    2. Malouf GG,
    3. Lu E,
    4. Sphyris N,
    5. Vijay V,
    6. Ramachandran PP,
    7. Ueno KR,
    8. Gaur S,
    9. Nicoloso MS,
    10. Rossi S,
    11. Herschkowitz JI,
    12. Rosen JM,
    13. Issa JP,
    14. Calin GA,
    15. Chang JT,
    16. Mani SA
    : Epigenetic silencing of microRNA-203 is required for EMT and cancer stem cell properties. Sci Rep 3: 2687, 2013. DOI: 10.1038/srep02687
    OpenUrlCrossRefPubMed
  19. ↵
    1. Jin J,
    2. Deng J,
    3. Wang F,
    4. Xia X,
    5. Qiu T,
    6. Lu W,
    7. Li X,
    8. Zhang H,
    9. Gu X,
    10. Liu Y,
    11. Cao W,
    12. Shao W
    : The expression and function of microRNA-203 in lung cancer. Tumour Biol 34(1): 349-357, 2013. DOI: 10.1007/s13277-012-0556-3
    OpenUrlCrossRefPubMed
    1. Ma T,
    2. Hu Y,
    3. Guo Y,
    4. Zhang Q
    : Human umbilical vein endothelial cells-derived microRNA-203-containing extracellular vesicles alleviate non-small-cell lung cancer progression through modulating the DTL/p21 axis. Cancer Gene Ther 29(1): 87-100, 2022. DOI: 10.1038/s41417-020-00292-3
    OpenUrlCrossRefPubMed
  20. ↵
    1. Liu X,
    2. Feng Y,
    3. Wang L,
    4. Shi L,
    5. Ji K,
    6. Hu N,
    7. Du Y,
    8. Liu M,
    9. Wang M
    : Silencing of circ_0088036 inhibits growth and invasion of lung adenocarcinoma through miR-203/SP1 axis. J Biochem Mol Toxicol 38(4): e23684, 2024. DOI: 10.1002/jbt.23684
    OpenUrlCrossRefPubMed
  21. ↵
    1. Wang N,
    2. Lin KK,
    3. Lu Z,
    4. Lam KS,
    5. Newton R,
    6. Xu X,
    7. Yu Z,
    8. Gill GN,
    9. Andersen B
    : The LIM-only factor LMO4 regulates expression of the BMP7 gene through an HDAC2-dependent mechanism, and controls cell proliferation and apoptosis of mammary epithelial cells. Oncogene 26(44): 6431-6441, 2007. DOI: 10.1038/sj.onc.1210465
    OpenUrlCrossRefPubMed
  22. ↵
    1. Wang W,
    2. Wu S,
    3. Guo M,
    4. He J
    : LMO4 is a prognostic marker involved in cell migration and invasion in non-small-cell lung cancer. J Thorac Dis 8(12): 3682-3690, 2016. DOI: 10.21037/jtd.2016.12.22
    OpenUrlCrossRefPubMed
  23. ↵
    1. Holik AZ,
    2. Filby CE,
    3. Pasquet J,
    4. Viitaniemi K,
    5. Ciciulla J,
    6. Sutherland KD,
    7. Asselin-Labat ML
    : The LIM-domain only protein 4 contributes to lung epithelial cell proliferation but is not essential for tumor progression. Respir Res 16(1): 67, 2015. DOI: 10.1186/s12931-015-0228-0
    OpenUrlCrossRefPubMed
  24. ↵
    1. Zhang Y,
    2. Wu Z,
    3. Yu H,
    4. Wang H,
    5. Liu G,
    6. Wang S,
    7. Ji X
    : Chinese herbal medicine Wenxia Changfu formula reverses cell adhesion-mediated drug resistance via the integrin β1-PI3K-AKT pathway in lung cancer. J Cancer 10(2): 293-304, 2019. DOI: 10.7150/jca.25163
    OpenUrlCrossRefPubMed
    1. Moghbeli M
    : PI3K/AKT pathway as a pivotal regulator of epithelial-mesenchymal transition in lung tumor cells. Cancer Cell Int 24(1): 165, 2024. DOI: 10.1186/s12935-024-03357-7
    OpenUrlCrossRefPubMed
  25. ↵
    1. McDaid WJ,
    2. Wilson L,
    3. Adderley H,
    4. Martinez-Lopez A,
    5. Baker MJ,
    6. Searle J,
    7. Ginn L,
    8. Budden T,
    9. Aldea M,
    10. Marinello A,
    11. Aredo JV,
    12. Viros A,
    13. Besse B,
    14. Wakelee HA,
    15. Blackhall F,
    16. Castillo-Lluva S,
    17. Lindsay CR,
    18. Malliri A
    : The PI3K-AKT-mTOR axis persists as a therapeutic dependency in KRAS(G12D)-driven non-small cell lung cancer. Mol Cancer 23(1): 253, 2024. DOI: 10.1186/s12943-024-02157-x
    OpenUrlCrossRefPubMed
  26. ↵
    1. Pal I,
    2. Mandal M
    : PI3K and Akt as molecular targets for cancer therapy: current clinical outcomes. Acta Pharmacol Sin 33(12): 1441-1458, 2012. DOI: 10.1038/aps.2012.72
    OpenUrlCrossRefPubMed
  27. ↵
    1. Huang D,
    2. He X,
    3. Zou J,
    4. Guo P,
    5. Jiang S,
    6. Lv N,
    7. Alekseyev Y,
    8. Luo L,
    9. Luo Z
    : Negative regulation of Bmi-1 by AMPK and implication in cancer progression. Oncotarget 7(5): 6188-6200, 2016. DOI: 10.18632/oncotarget.6748
    OpenUrlCrossRefPubMed
  28. ↵
    1. Zhou J,
    2. Yang Z,
    3. Tsuji T,
    4. Gong J,
    5. Xie J,
    6. Chen C,
    7. Li W,
    8. Amar S,
    9. Luo Z
    : LITAF and TNFSF15, two downstream targets of AMPK, exert inhibitory effects on tumor growth. Oncogene 30(16): 1892-1900, 2011. DOI: 10.1038/onc.2010.575
    OpenUrlCrossRefPubMed
    1. Guan J,
    2. Zhang ZY,
    3. Sun JH,
    4. Wang XP,
    5. Zhou ZQ,
    6. Qin L
    : LITAF inhibits colorectal cancer stemness and metastatic behavior by regulating FOXO1-mediated SIRT1 expression. Clin Exp Metastasis 40(4): 309-320, 2023. DOI: 10.1007/s10585-023-10213-x
    OpenUrlCrossRefPubMed
  29. ↵
    1. Zhou Y,
    2. Huang J,
    3. Yu X,
    4. Jiang X,
    5. Shi Y,
    6. Weng Y,
    7. Kuai Y,
    8. Lei L,
    9. Ren G,
    10. Feng X,
    11. Zhong G,
    12. Liu Q,
    13. Pan H,
    14. Zhang X,
    15. Zhou R,
    16. Lu C
    : LITAF is a potential tumor suppressor in pancreatic cancer. Oncotarget 9(3): 3131-3142, 2017. DOI: 10.18632/oncotarget.23220
    OpenUrlCrossRefPubMed
  30. ↵
    1. Liu PJ,
    2. Chen YH,
    3. Tsai KW,
    4. Yeah HY,
    5. Yeh CY,
    6. Tu YT,
    7. Yang CY
    : Involvement of microRNA-1-FAM83A axis dysfunction in the growth and motility of lung cancer cells. Int J Mol Sci 21(22): 8833, 2020. DOI: 10.3390/ijms21228833
    OpenUrlCrossRefPubMed
  31. ↵
    1. Almeida SFF,
    2. Santos L,
    3. Sampaio-Ribeiro G,
    4. Ferreira HRS,
    5. Lima N,
    6. Caetano R,
    7. Abreu M,
    8. Zuzarte M,
    9. Ribeiro AS,
    10. Paiva A,
    11. Martins-Marques T,
    12. Teixeira P,
    13. Almeida R,
    14. Casanova JM,
    15. Girão H,
    16. Abrunhosa AJ,
    17. Gomes CM
    : Unveiling the role of osteosarcoma-derived secretome in premetastatic lung remodelling. J Exp Clin Cancer Res 42(1): 328, 2023. DOI: 10.1186/s13046-023-02886-9
    OpenUrlCrossRefPubMed
  32. ↵
    1. Han AL,
    2. Veeneman BA,
    3. El-sawy L,
    4. Day KC,
    5. Day ML,
    6. Tomlins SA,
    7. Keller ET
    : Fibulin-3 promotes muscle-invasive bladder cancer. Oncogene 36(37): 5243-5251, 2017. DOI: 10.1038/onc.2017.149
    OpenUrlCrossRefPubMed
  33. ↵
    1. Yang X,
    2. Zhang M,
    3. Xia W,
    4. Mai Z,
    5. Ye Y,
    6. Zhao B,
    7. Song Y
    : CHAC1 promotes cell ferroptosis and enhances radiation sensitivity in thyroid carcinoma. Neoplasma 70(06): 777-786, 2024. DOI: 10.4149/neo_2023_230103N4
    OpenUrlCrossRef
  34. ↵
    1. Chen C,
    2. Zhai E,
    3. Liu Y,
    4. Qian Y,
    5. Zhao R,
    6. Ma Y,
    7. Liu J,
    8. Huang Z,
    9. Chen J,
    10. Cai S
    : ALKBH5-mediated CHAC1 depletion promotes malignant progression and decreases cisplatin-induced oxidative stress in gastric cancer. Cancer Cell Int 23(1): 293, 2023. DOI: 10.1186/s12935-023-03129-9
    OpenUrlCrossRefPubMed
  35. ↵
    1. He S,
    2. Zhang M,
    3. Ye Y,
    4. Zhuang J,
    5. Ma X,
    6. Song Y,
    7. Xia W
    : ChaC glutathione specific γ-glutamylcyclotransferase 1 inhibits cell viability and increases the sensitivity of prostate cancer cells to docetaxel by inducing endoplasmic reticulum stress and ferroptosis. Exp Ther Med 22(3): 997, 2021. DOI: 10.3892/etm.2021.10429
    OpenUrlCrossRefPubMed
PreviousNext
Back to top

In this issue

Cancer Genomics - Proteomics: 22 (5)
Cancer Genomics & Proteomics
Vol. 22, Issue 5
September-October 2025
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover
  • Index by author
  • Ed Board (PDF)
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word on Cancer Genomics & Proteomics.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
LOC100506691 Is an Oncogenic Long Noncoding RNA that Promotes Growth and Motility of Lung Cancer Cells
(Your Name) has sent you a message from Cancer Genomics & Proteomics
(Your Name) thought you would like to see the Cancer Genomics & Proteomics web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
6 + 1 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Citation Tools
LOC100506691 Is an Oncogenic Long Noncoding RNA that Promotes Growth and Motility of Lung Cancer Cells
YU-HSUAN CHEN, CHIH-YUN YANG, PEI-JUNG LIU, WAN-CHUNG HU, KUO-CHENG LU, CHING-FENG CHENG, KUO-WANG TSAI
Cancer Genomics & Proteomics Sep 2025, 22 (5) 775-790; DOI: 10.21873/cgp.20536

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Reprints and Permissions
Share
LOC100506691 Is an Oncogenic Long Noncoding RNA that Promotes Growth and Motility of Lung Cancer Cells
YU-HSUAN CHEN, CHIH-YUN YANG, PEI-JUNG LIU, WAN-CHUNG HU, KUO-CHENG LU, CHING-FENG CHENG, KUO-WANG TSAI
Cancer Genomics & Proteomics Sep 2025, 22 (5) 775-790; DOI: 10.21873/cgp.20536
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Conclusion
    • Acknowledgements
    • Footnotes
    • References
  • Info & Metrics
  • PDF

Related Articles

Cited By...

  • Clinical Data Analysis Identifies Prognostic Long Non-coding RNA Signatures in Lung Adenocarcinoma
  • Google Scholar

More in this TOC Section

  • Proximity Mapping of the ER Proteome Reveals Metastasis-specific Candidate Biomarkers in Breast Cancer Cell Lines
  • Integrated Proteomics Reveal ALDH1A1 as an Oncogenic Driver and Regulatory Hub in Hepatocellular Carcinoma
  • LGALS3BP Links Centrosomes and Mitochondria to Maintain Energetic Fitness and Restrain Compensatory Lipid Catabolic Reprogramming in Hepatocellular Carcinoma
Show more Experimental Studies

Keywords

  • LncRNA
  • lung cancer
  • LOC100506691
  • noncoding RNA
  • cell cycle
Cancer & Genome Proteomics

© 2026 Cancer Genomics & Proteomics

Powered by HighWire