Abstract
Background/Aim: BRCA1/2 mutations in breast cancer cells impair homologous recombination and promote alternative end joining (Alt-EJ) for DNA-damage repair. DNA polymerase theta, encoded by POLQ, plays a crucial role in Alt-EJ, making it a potential therapeutic target, particularly in BRCA1/2-mutant cancers. Methionine restriction is a promising approach to target cancer cells due to their addiction to this amino acid. The present study investigated the expression of POLQ in BRCA1/2 wild-type and BRCA1-mutant breast cancer cells under methionine restriction. Materials and Methods: POLQ mRNA expression was measured using qRT-PCR in BRCA1/2 wild-type (MDA-MB-231) and BRCA1- mutant (HCC1937 and MDA-MB-436) breast-cancer cells under normal, or serum-restricted, or serum- and methionine-restricted conditions. Results: Compared to BRCA1/2 wild-type cells, BRCA1-mutant cells displayed significantly higher basal POLQ expression in normal medium. Methionine restriction further increased POLQ expression in the BRCA1-mutant cells but decreased it in the BRCA1/2 wild-type cells. Conclusion: The present findings suggest that methionine restriction showed differential effects on POLQ expression, potentially impacting Alt-EJ activity, in BRCA1/2 wild-type and BRCA1-mutant breast-cancer cells. Further investigation is needed to explore the potential of combining methionine restriction with DNA-repair inhibitors, such as PARP inhibitors, to overcome drug resistance in BRCA1/2 mutant cancers.
- BRCA1/2
- mutations
- DNA repair
- POLQ
- induction
- methionine restriction
- breast cancer
- methionine addiction
- Hoffman effect
BRCA1/2 genes encode proteins responsible for DNA- damage repair and play a critical role in hereditary breast and ovarian cancer (HBOC). BRCA1/2 is involved in the repair of DNA double-strand breaks through homologous recombination (1, 2). Homologous recombination (HR) and non-homologous end joining (NHEJ) are the primary mechanisms for repairing double-strand breaks (DSBs) in DNA damage. In HR, DNA damage is repaired using sister chromosomes as a template during the S-phase to G2-phase transition of the cell cycle (3). NHEJ is a repair mechanism that works regardless of the phase of the cell cycle and immediately joins DNA ends together after minimal repair of DSBs. In addition, there are other repair mechanisms such as alternative end joining (Alt-EJ) (4-6). In cells with BRCA1/2 mutations, DNA repair through HR does not function normally, and other DNA repair pathways are enhanced.
Administration of PARP inhibitors to BRCA1/2 mutant cells, in which HR does not function and DNA repair cannot be normally performed, leads to cell death. Therefore, PARP inhibitors are in clinical use for several cancers that carry BRCA1/2 mutations, including breast cancer (7). However, BRCA1/2 mutant cells that are unable to undergo DNA repair by HR develop resistance to PARP inhibitors due to increased DNA repair by other DNA double-strand repair mechanisms.
DNA polymerase theta (Polθ) is a promising therapeutic target for overcoming PARP inhibitor resistance (8-10). Polθ is an enzyme encoded by the POLQ gene and plays an important role in Alt-EJ (11). Therefore, end-joining repair mediated by polymerase theta is also called theta-mediated end joining (TMEJ). In cells where HR is not active, DNA damage repair by Alt-EJ increases.
Methionine addiction is an increased need for exogenous methionine for cancer-cell proliferation and survival (12-30). Methionine restriction arrests cancer cells in the S/G2-phase of the cell cycle but does not arrest the cell cycle of normal cells in S/G2 phase (12). Therefore, many chemotherapy drugs targeting the S/G2-phase of the cell cycle have synergistic efficacy with methionine restriction transition of cancer cells (13). Since DNA repair mechanisms differ depending on the phase of the cell cycle, methionine restriction of cancer cells may also affect DNA repair through S/G2 phase cell-cycle arrest.
We observed that methionine restriction arrested cancer-cell proliferation, while simultaneously enhancing the secretion of exosomes (14). Thus, the effects of methionine restriction on cancer present multiple promising therapeutic approaches. The aim of the present study was to examine the expression of POLQ in BRCA1/2 wild-type and BRCA1-mutant breast-cancer cells under methionine restriction.
Materials and Methods
Cells. MDA-MB-231 is a BRCA1/2 wild-type triple-negative breast cancer (TNBC) cell line. MDA-MB-436 and HCC1937 are BRCA1-mutant breast-cancer cell lines. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Fujifilm Wako Pure Chemical Co, Osaka, Japan) supplemented with 10% fetal bovine serum (FBS) (Nicherei Biosciences Inc., Tokyo, Japan) and 100 IU/ml penicillin/streptomycin (Thermo Fisher Scientific, Waltham, MA, USA) and incubated at 37°C in an atmosphere of 5% CO2. The cells were washed with phosphate-buffered saline (PBS) (Fujifilm Wako Pure Chemical Co), and the culture medium was replaced with either normal DMEM (FBS+, MET+) or DMEM without FBS (FBS−, MET+) or DMEM (Thermo Fisher Scientific) without FBS and methionine (FBS−, MET−) (15). FBS− medium was used with methionine restriction because FBS contains large amounts of methionine.
mRNA extraction and qRT-PCR. mRNAs were extracted from cells using an RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. For qRT-PCR analysis, cDNAs were generated from total RNA using a Prime Script™ RT reagent Kit with gDNA Eraser (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s protocol. The cDNA samples were stored at −20°C until further use. Real-time PCR was performed in triplicate with diluted cDNAs using TB Green Premix Ex Taq (Takara Bio Inc.).
Primers for measuring POLQ expression by qRT- PCR. POLQ mRNA is a relatively long molecule containing both a helicase domain and a polymerase domain. Primer POLQ-5 for the helicase domain, primer POLQ-1 and primer POLQ-3 for the polymerase domain were synthesized (16). The primers used in this study were as follows: ACTIN-F: CAAGGCCAACCGCGAGAAGATGAC, ACTIN-R: GC CAGAGGCGTACAGGGATAGCACA; POLQ-F1: CACACTGCTAC AGGACGAATAA, POLQ-R1: AGGTGGGCTTTCTCCTACTA; POLQ-F3 GGCACAGATGGAGGAGAGAG, POLQ-R3: TGCTGCA ATGCTCCTGAAAAC; POLQ-F5: AATGGTGTGAGAAGCTGGCA, POLQ-R5: GGTGGGCATTCAGAGGGTTT.
Statistical analysis. One-way ANOVA with the Bonferroni-Dunn correction was used to determine the differential expression of mRNAs between the two groups. Statistical analyses were performed using Statcel 4 Software (OMS Publishing Inc., Tokyo, Japan).
Results
POLQ 1, 3 and 5 mRNA expression of BRCA1/2 wild-type and BRCA1-mutant breast-cancer cells in normal serum-and methionine-containing medium. POLQ 1,3 and 5 mRNA expression in BRCA1/2 wild-type MDA-MB-231 cells in normal medium was set as 1.0. The MDA-MB-231 cell line showed significantly lower POLQ mRNA expression compared to both BRCA1-mutant HCC1937 and MDA-MB-436 cell lines in normal medium (p<0.01) (Figure 1).
POLQ mRNA expression level of cultured BRCA1/2-wild-type and BRCA1-mutant breast cancer cells in normal medium. **p<0.01 using one-way ANOVA followed by Bonferroni-Dunn correction, demonstrating significant differences between BRCA1/2-wild-type and BRCA1-mutant breast-cancer cell lines in normal medium.
POLQ 1,3 and 5 mRNA expression in BRCA1/2 wild-type MDA-MB-231 cells under methionine restriction. MDA-MB-231 cells were seeded in normal methionine-containing medium, then the medium was replaced with normal medium or FBS-restricted medium (FBS−, MET+) or FBS- and methionine-restricted medium (FBS−, MET−) after one day. Cells were harvested after 48 h, mRNA was extracted, and the expression level of POLQ was analyzed by qPCR. In MDA-MB-231 cells, POLQ 1,3 and 5 mRNA expression was significantly lower in FBS−, MET− medium than in normal medium (p<0.01). POLQ 1,3 and 5 mRNA expression was also significantly lower in FBS−, MET− medium than in FBS−, MET+ medium (p<0.01) (Figure 2).
Comparison of POLQ 1,3 and 5 mRNA expression levels in BRCA1/2 wild-type and BRCA1-mutant breast-cancer cell lines under methionine restriction. *p<0.05 and **p<0.01 using one-way ANOVA followed by Bonferroni-Dunn correction, demonstrating significant differences in POLQ 1,3 and 5 expression between normal medium (FBS+, MET+) and FBS-restricted medium (FBS−, MET+) and FBS− and methionine-restricted medium (FBS−, MET−) in the BRCA1/2 wild-type and BRCA1-mutant breast-cancer cell lines.
POLQ 1,3 and 5 mRNA expression in BRCA1-mutant HCC1937 and MDA-MB-436 cells under methionine restriction. HCC1937 cells were seeded in normal medium which was then switched to FBS−, MET+ medium or FBS−, MET− medium after one day. In HCC1937 cells, the expression of POLQ 1,3 and 5 increased in FBS−, MET− medium compared to normal medium (p<0.05) and in FBS−, MET− medium compared to FBS−, MET+ medium (p<0.01) (Figure 2). MDA-MB-436 cells were also seeded in normal medium which was switched to FBS−, MET+ medium or FBS−, MET− medium after one day. The expression of POLQ 1,3 and 5 increased in FBS−, MET− medium compared to normal medium (p<0.05) and in FBS−, MET− medium compared to FBS−, MET+ medium (p<0.01) (Figure 2).
Discussion
POLQ expression was higher in BRCA1 mutant breast cancer cell lines HCC1937 and MDA-MB-436 compared to BRCA1/2 wild-type breast-cancer cell line MDA-MB-231 in normal medium (Figure 1). BRCA1/2 wild-type breast-cancer cells can repair DNA damage by homologous recombination (HR). However, since BRCA1/2 plays an important role in HR, BRCA1/2-mutant breast-cancer cells cannot repair DNA damage by HR, and therefore non-homologous end joining (NHEJ) or alternative end joining (Alt-EJ) are enhanced instead. DNA polymerase theta (Polθ) is an enzyme encoded by the POLQ gene and plays an important role in Alt-EJ, which may explain why POLQ expression is increased in BRCA1-mutant breast-cancer cell lines compared to a BRCA1/2 wild-type breast-cancer cell line.
Under methionine restriction, the expression of POLQ decreased in BRCA1/2 wild-type breast-cancer cell line MDA-MB-231, while it increased in BRCA1-mutant breast-cancer cell lines HCC1937 and MDA-MB-436 (Figure 2).
POLQ is a relatively large gene containing both a helicase domain and a polymerase domain. Therefore, three locations in POLQ mRNA were analyzed by qRT-PCR for measuring expression: primer POLQ-5 for the helicase domain, primer POLQ-1 and primer POLQ-3 for the polymerase domain (16).
Cancer cells are methionine addicted and, unlike normal cells, cannot survive without large amounts of exogeneous methionine. Methionine addiction of cancer is termed the Hoffman effect (17-19). Both cancer cells and normal cells synthesize methionine from homocysteine (17-19), but cancer cells consume large amounts of methionine (18, 19) and therefore require exogenous methionine. Cancer cells selectively arrest in the late S/G2-phase of the cell cycle when methionine is depleted (12). Synergistic efficacy of various anticancer drugs which target the S-phase of the cell cycle and methionine restriction have been reported in mice and humans (13, 15, 20-28). In addition, no side effects related to methionine restriction have been reported in human studies of cancer treatment that combines anticancer drugs and methionine restriction (the Hoffman protocol) (24, 25).
Aoki et al. have suggested that elevated c-MYC may be a biomarker for methionine addiction of cancer cells (29). Higuchi et al. have suggested that a combination of oral-recombinant methioninase (o-rMETase) with decitabine (DAC), an inhibitor of a DNA methylation, and an inhibitor of S-adenosylmethionine (SAM) synthesis, cycloleucine, can effectively target methionine-addicted cancer cells (30).
A possible explanation of why methionine restriction inhibited POLQ expression in the BRCA1/2 wild-type cells and induced POLQ expression in the BRCA1 mutant cells is that in the BRCA1/2 wild-type cells, DNA damage, under methionine-restriction-induced S/G2-cell-cycle arrest, uses the normal DNA repair mechanism (homologous recombination) but in the BRCA1-mutant cells, in methionine-restriction-induced S/G2 cell-cycle arrest, DNA-damage repair by Alt-EJ increases, resulting in elevated expression of POLQ.
It was reported that POLQ is highly expressed in cancer cells, particularly in breast-cancer specimens compared to other DNA polymerases (31). It was also reported that POLQ was the gene with the largest difference in expression, when comparing DNA-repair genes between normal tissue and ovarian cancer which has a high proportion of BRCA1/2 mutations (32). POLQ is thus a promising cancer-treatment target.
In breast cancer and ovarian cancer with BRCA1/2 germline or somatic mutations, treatment with platinum-based chemotherapy or PARP inhibitors results in the impairment of DNA double-strand repair, leading to cell death (33-38). PARP inhibitors are also effective against prostate cancer and pancreatic cancer that have BRCA1/2 germline mutations (39, 40). Voutsadakis et al. have suggested homologous recombination defects and mutations in DNA-damage-response (DDR) genes beside BRCA1 and BRCA2 can be breast-cancer biomarkers for sensitivity to PARP inhibitors and other DDR-targeting therapies (41). However, resistance to these drugs is a problem.
Polθ encoded by POLQ is a promising therapeutic target for drug resistance in cancers with BRCA1/2 mutations. Further research on methionine-restriction and its impact on POLQ-catalyzed Alt-EJ in BRCA1/2 mutant cells is necessary.
Conclusion
The present results suggest that methionine-restriction creates an environment in which BRCA1/2-mutant breast-cancer cells are more likely to use Alt-EJ during S/G2 cell-cycle arrest. This holds promise for the development of new therapies to overcome resistance to PARP inhibitors by combining PARP inhibition with methionine restriction. The present results have future clinical potential for patients with BRCA1/2 mutations. In the future, we intend to carry out experiments involving the administration of PARP inhibitors combined with methionine restriction of cancer cells, with orally-administered methioninase (42, 43), including in the clinic where oral methioninase has shown promise against recalcitrant cancer (24, 25, 28, 44, 45).
Footnotes
Conflicts of Interest
TK and HT have received research grants from Ono Pharmaceutical Co. Ltd. TK is a lecturer in an endowed chair funded by Hyogo Prefecture. RMH declares no conflicts of interest.
Authors’ Contributions
Conception and design: TK, SI, and HT. SI performed the experiments. Interpretation of results: TK, SI, HT and RMH. Manuscript writing: TK and RMH. Approval of manuscript: All Authors.
- Received March 23, 2024.
- Revision received May 23, 2024.
- Accepted June 3, 2024.
- Copyright © 2024 The Author(s). Published by the International Institute of Anticancer Research.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).
