Skip to main content

Main menu

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • Anticancer Research
    • In Vivo
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
  • About Us
    • General Policy
    • Contact
  • Other Publications
    • Cancer Genomics & Proteomics
    • Anticancer Research
    • In Vivo

User menu

  • Register
  • Subscribe
  • My alerts
  • Log in
  • My Cart

Search

  • Advanced search
Cancer Genomics & Proteomics
  • Other Publications
    • Cancer Genomics & Proteomics
    • Anticancer Research
    • In Vivo
  • Register
  • Subscribe
  • My alerts
  • Log in
  • My Cart
Cancer Genomics & Proteomics

Advanced Search

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • Anticancer Research
    • In Vivo
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
  • About Us
    • General Policy
    • Contact
  • Visit iiar on Facebook
  • Follow us on Linkedin
Research ArticleArticle
Open Access

Recurrent 8q11-13 Aberrations Leading to PLAG1 Rearrangements, Including Novel Chimeras HNRNPA2B1::PLAG1 and SDCBP::PLAG1, in Lipomatous Tumors

IOANNIS PANAGOPOULOS, KRISTIN ANDERSEN, LUDMILA GORUNOVA, MARIUS LUND-IVERSEN, INGVILD LOBMAIER, FRANCESCA MICCI and SVERRE HEIM
Cancer Genomics & Proteomics March 2023, 20 (2) 171-181; DOI: https://doi.org/10.21873/cgp.20372
IOANNIS PANAGOPOULOS
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: ioannis.panagopoulos{at}rr-research.no
KRISTIN ANDERSEN
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
LUDMILA GORUNOVA
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
MARIUS LUND-IVERSEN
2Department of Pathology, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
INGVILD LOBMAIER
2Department of Pathology, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
FRANCESCA MICCI
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
SVERRE HEIM
1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Background/Aim: Structural abnormalities of chromosome bands 8q11-13, resulting in rearrangement of the pleomorphic adenoma gene 1 (PLAG1), are known to characterize lipoblastoma, a benign fat cell tumor, found mainly in children. Here, we describe 8q11-13 rearrangements and their molecular consequences on PLAG1 in 7 lipomatous tumors in adults. Materials and Methods: The patients were 5 males and 2 females between 23 and 62 years old. The tumors, namely five lipomas, one fibrolipoma and one spindle cell lipoma, were examined using G-banding with karyotyping, fluorescence in situ hybridization (FISH; three tumors), RNA sequencing, reverse transcription (RT) PCR, and Sanger sequencing analyses (two tumors). Results: All 7 tumors had karyotypic aberrations which included rearrangements of chromosome bands 8q11-13 (the criterion for selection into this study). FISH analyses with a PLAG1 break apart probe showed abnormal hybridization signals in both interphase nuclei and on metaphase spreads indicating PLAG1 rearrangement. RNA sequencing detected fusion between exon 1 of heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) and exon 2 or 3 of PLAG1 in a lipoma and fusion between exon 2 of syndecan binding protein (SDCBP) and exon 2 or 3 of PLAG1 in a spindle cell lipoma. The HNRNPA2B1::PLAG1 and SDCBP::PLAG1 fusion transcripts were confirmed using RT-PCR/Sanger sequencing analyses. Conclusion: As 8q11-13 aberrations/PLAG1-rearrangements/PLAG1-chimeras may evidently be a defining pathogenetic feature of lipogenic neoplasms of several histological types and not just lipoblastomas, we suggest that the term “8q11-13/PLAG1-rearranged lipomatous tumors” be generally adopted for this tumor subset.

Key Words
  • Chromosome band 8q11-13
  • pleomorphic adenoma gene 1
  • PLAG1 fusion genes
  • HNRNPA2B1::PLAG1
  • SDCBP::PLAG1
  • lipoma
  • lipoblastoma
  • lipomatous tumors

The pleomorphic adenoma gene 1 (PLAG1), which is located in chromosome subband 8q12.1, was initially found to be rearranged in pleomorphic adenomas carrying the reciprocal chromosome translocation t(3;8)(p22;q12). The translocation resulted in fusion of PLAG1 with the catenin beta 1 (CTNNB1) gene from 3p22.1, generating two reciprocal chimeras, CTNNB1::PLAG1 and PLAG1::CTNNB1 (1). The fusion points were in the 5′-end non-coding regions of both genes bringing the coding sequence of PLAG1 under the control of the CTNNB1 promoter whereas the coding region of CTNNB1 came under the control of the PLAG1 promoter. The result was high expression of PLAG1 and reduced expression of CTNNB1 (1). Subsequently, numerous chimeras in which PLAG1 is the 3′-end partner gene have been described in various tumors (2-11). As a consequence, the PLAG1 gene becomes either overexpressed or activated resulting in deregulation of the genes it targets, ultimately leading to tumor development (12-16).

In adipocytic neoplasms, structural abnormalities of chromosome bands 8q11-13 resulting in rearrangement of PLAG1 are recognized as the genetic hallmarks of lipoblastomas, i.e., benign, predominantly pediatric neoplasms composed of embryonal white fat (4, 5, 7, 9, 17-20). The vast majority of lipoblastomas are found before the age of three years (19, 20). Only a few lipoblastomas have been described in adolescents, and even fewer in adults (17, 18, 21-23).

In addition to lipoblastomas, structural abnormalities of chromosome bands 8q11-13 have also been reported in other lipomatous tumors, namely eight lipomas, two atypical lipomas/well differentiated liposarcomas, and one hibernoma (Table I) (24-31). In a well differentiated liposarcoma and a lipoma, these chromosomal changes were demonstrated to correspond to PLAG1 rearrangements (28, 29). In the present study, we report another 7 lipomatous tumors carrying 8q11-13 structural chromosomal rearrangements and describe their molecular consequences on the PLAG1 gene.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table I.

Lipomatous tumors reported with structural chromosome rearrangements involving bands 8q11-13.

Materials and Methods

Materials. Information about patients’ sex and age, diagnosis, and tumor locations is given in Table II. There were 5 males and 2 females between 23 and 62 years old. The diagnosis was lipoma (5 cases), fibrolipoma (1 case), and spindle cell lipoma (1 case). As part of this study, all tumors were re-evaluated by an experienced sarcoma pathologist (IL). The study was approved by the Regional Ethics Committee (Regional komité for medisinsk forskningsetikk Sør-Øst, Norge, http://helseforskning.etikkom.no). All patient information has been de-identified.

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table II.

Clinicopathological data, karyotypes, interphase FISH results of the PLAG1 and HMGA2, and PLAG1-fusion transcripts in seven lipomatous tumors.

G-Banding and karyotyping. As part of our diagnostic routine, fresh tissues from a representative area of resected tumors were received and analyzed cytogenetically. The methodology for cytogenetic investigation of solid tumors was described elsewhere (32). In brief, the samples were disaggregated mechanically and enzymatically with collagenase II (Worthington, Freehold, NJ, USA) and the resulting cells were cultured and harvested using standard techniques (33, 34). Chromosome preparations were G-banded with Wright’s stain (Sigma-Aldrich; St Louis, MO, USA) and examined. Metaphases were analyzed and karyograms prepared using the CytoVision computer assisted karyotyping system (Leica Biosystems, Newcastle, UK). The karyotypes were described according to the International System for Human Cytogenomic Nomenclature (35).

Fluorescence in situ hybridization (FISH) analysis. Homemade break-apart PLAG1 and HMGA2 probes were used. The probes were made from commercially available bacterial artificial chromosomes (BAC) purchased from BACPAC Resource Center operated by BACPAC Genomics, Emeryville, CA, USA (https://bacpacresources.org/). The BAC probes were based on the contigs used to construct the GRCh38 (hg38) genome assembly (Table III). The FISH probes were prepared from bacteriophage Phi29 DNA polymerase-amplified BAC DNAs using previously described methodology and kits for DNA isolation, amplification, labelling, and hybridization according to the manufacturers’ recommendations (36-38). In brief, single isolated bacterial colonies were grown in 5 ml Luria-Bertani (LB) broth medium overnight, and BAC DNA was purified using the QIAprep Spin Miniprep Kit together with Qiacube (Qiagen, Hilden, Germany). After purification, BAC DNAs were amplified with Phi29 DNA polymerase using the GenomiPhi V2 DNA Amplification kit (Cytiva, Marlborough, MA, USA). Subsequently, the Phi29 amplified DNA was labelled and hybridized using Abbott’s nick (Abbott Molecular, Des Plaines, IL, USA) translation kit according to the manufacturer’s recommendations (36). The centromeric, proximal part of probes of both PLAG1 and HMGA2 genes were labelled with Texas Red-5-dCTP (PerkinElmer, Boston, MA, USA) in order to obtain a red signal. The telomeric, distal part of the probes was labelled with fluorescein-12-dCTP (PerkinElmer) in order to obtain a green signal. FISH mapping of the probes on normal controls was performed to confirm their chromosomal location. Chromosome preparations were counterstained with 0.2 μg/ml 4′,6-diamidino-2-phenylindole (DAPI) and overlaid with a 24×50 mm2 coverslip. Fluorescent signals were captured and analyzed using the CytoVision system (Leica Biosystems).

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table III.

BAC probes used for fluorescence in situ hybridization (FISH) experiments in order to detect rearrangements of the pleomorphic adenoma gene 1 (PLAG1) and the high-mobility group AT-hook 2 (HMGA2) gene. The positions of the PLAG1 and HMGA2 genes are also given.

RNA sequencing. Total RNA was extracted from frozen tumor tissue adjacent to that used for cytogenetic analysis and histologic examination using the miRNeasy Mini Kit (Qiagen) and 1 μg of RNA was sent to the Genomics Core Facility at the Norwegian Radium Hospital, Oslo University Hospital for high-throughput paired-end RNA-sequencing. The FASTQC software was used for quality control of the raw sequence data (available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Fusion transcripts were found using the FusionCatcher software (39).

Reverse transcription (RT) PCR and Sanger sequencing analyses. The primers used for PCR amplifications are shown in Table IV. The methodologies for cDNA synthesis and RT-PCR amplification are described elsewhere (8, 40, 41). 3 μl of the PCR products were stained with GelRed (Biotium, Hayward, CA, USA), analyzed by electrophoresis through 1.0% agarose gel, and photographed. Gel electrophoresis was performed using lithium borate buffer (42). The remaining PCR products were purified using the MinElute PCR Purification Kit (Qiagen) and cloned into the pCR4-TOPO vector using TOPO TA Cloning Kit for Sequencing, according to the manufacturer’s recommendations (ThermoFisher Scientific, Waltham, MA, USA). Single isolated bacterial colonies were picked and cultured overnight in 5 ml LB broth medium. Plasmid DNAs were isolated using QIAprep Spin Miniprep Kit together with Qiacube (Qiagen) and sequenced using T3 and T7 primers. Sequencing was run on the Applied Biosystems SeqStudio Genetic Analyzer system (ThermoFisher Scientific). The basic local alignment search tool (BLAST) was used to compare the sequences which were obtained by Sanger sequencing with the NCBI reference sequences NM_002655.2 (Pleomorphic adenoma gene 1, PLAG1), NM_002137.4 (heterogeneous nuclear ribonucleoprotein A2/B1, HNRNPA2B1), and NM_005625.4 (syndecan binding protein, SDCBP) (43). They were also aligned on the Human GRCh37/hg19 assembly using the BLAST-like alignment tool (BLAT) and the human genome browser hosted by the University of California, Santa Cruz (44, 45).

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table IV.

Designation, sequence (5′->3′), and position in reference sequences of the forward (F) and reverse (R) primers of the pleomorphic adenoma gene 1 (PLAG1), heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), and the syndecan binding protein (SDCBP) genes, which were used for polymerase chain reaction amplification.

Results

Karyotyping. All tumors had cells carrying clonal chromosomal aberrations (Table II). The abnormal karyotypes were pseudo- or near-diploid and had aberrations involving chromosome bands 8q11-q13 (Figure 1; this was the basis on which the cases were selected). No two tumors were karyotypically identical. Nevertheless, in tumors 3, 4, and 7, recombination between bands p31-34 on the short arm of chromosome 1 and 8q11-13 had occurred (Table II, Figure 1). Three tumors (numbers 1, 2, and 6) had a simple balanced translocation, one tumor (number 4) had a seemingly balanced three-way translocation, whereas three tumors (numbers 3, 5, and 7) carried unbalanced translocations (Table II). Figure 1 shows partial karyograms for tumors 1 to 7 demonstrating their 8q11-13 rearrangements.

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

Cytogenetic analysis of lipomatous tumors. Partial karyotypes showing 8q11-13 abnormalities. The derivative (der) chromosomes together with the corresponding normal chromosome homologs are shown. For tumor 1, the der(X)t(X;8)(q24;q11∼12) and der(8) t(X;8)(q24;q11∼12) together with chromosome 8 are shown. For tumor 2, both der(8) chromosomes of the translocation t(8;8)(q12∼13;q22) are shown. For tumor 3, the der(1)t(1;8)(p34∼35;q11) together with chromosomes 1 and 8 are shown. For tumor 4, der(1), der(5), and der(8) of t(1;8;5)(p34;q12∼13;q15) together with chromosomes 1, 5, and 8 are shown. For tumor 5, der(3)t(3;8)(q13;p21),der(8)t(3;8)(q13; p21)del(8)(q12∼13q22) together with chromosomes 3 and 8 are shown. For tumor 6, der(7) t(7;8)(p15∼21;q12∼13) and der(8)t(7;8)(p15∼21;q12∼13) together with chromosomes 7 and 8 are shown. For tumor 7 der(1)t(1;8)(p31;q12∼13) and der(8)t(1;8)(p34;q12∼13) together with chromosomes 1 and 8 are shown.

FISH analysis. Cells for FISH analyses were available for three tumors (numbers 2, 3, and 4). The results are presented in Table II. In tumor 2, 48 out of 100 examined interphase nuclei showed a split of the PLAG1 break-apart probe (Table III, Figure 2A). FISH on metaphase spreads showed that the proximal red part of the PLAG1 break-apart probe (Figure 2A) hybridized to the short der(8), whereas the distal green part of the probe hybridized to the long der(8) (Figure 2B). In tumor 3, 67 out of 100 examined interphase nuclei lacked the proximal red part of the PLAG1-probe (Table III). Loss of the proximal red part of the probe (Figure 2A) was also found in metaphase spreads whereas the distal green part of the probe hybridized to der(1) (Figure 2A and B). In tumor 4, loss of the distal green signal of the probe was found in 100 out of 107 interphase nuclei (Table III). FISH on metaphase spreads showed that the proximal red part of the probe hybridized to der(8) confirming the lack of the distal green part of the probe (Figure 2A and B). FISH with a break-apart probe for HMGA2 (Table III) revealed no HMGA2 rearrangements on 100 examined interphase nuclei from each of tumors 2, 3, and 4 (Table II).

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Fluorescence in situ hybridization on metaphase spreads using a PLAG1 break-apart probe. (A) Ideogram of chromosome 8 showing the mapping of PLAG1 on chromosome sub-band 8q12.1 and the centromeric proximal (red) and telomeric distal (green) parts of the PLAG1 break apart probe. (B) Metaphase spreads of tumors 2, 3, and 4 showing the hybridization patterns of the PLAG1 break-apart probe. Green/red signal indicates intact PLAG1 locus. In tumor 2, the proximal red part of the PLAG1 break-apart probe is hybridized to the short der(8), whereas the distal green part of the probe is hybridized to the long der(8), distal to the red/green signal of the intact PLAG1. In tumor 3, the proximal red signal is absent, the distal green part of the probe is hybridized to der(1), and the green/red signal is hybridized to normal chromosome 8. In tumor 4, the proximal red part of the probe is hybridized to der(8), the distal green signal is absent and the green/red signal is hybridized to the normal chromosome 8.

RNA sequencing, RT-PCR, and Sanger sequencing analyses Samples for RNA sequencing were available only for tumors 6 and 7. In tumor 6, a lipoma with t(7;8)(p15∼21;q12), analysis of the raw RNA sequencing data with FusionCatcher detected two fusion transcripts between HNRNPA2B1 and PLAG1. In the first transcript, exon 1 of HNRNPA2B1 fused to exon 2 of PLAG1: GGCTGCGGGAAATCGGGCTGAAGCGACTGAG TCCGCGATGGAG::GTTGCCTCTTGGTGCTGCCTTGGCC GTATTTGGCACCCAGAAT. In the second transcript, exon 1 of HNRNPA2B1 fused to exon 3 of PLAG 1: GGCT GCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATG GAG:: ATTGGCCAAAATGGGAAGGATTGGATTCCACTC TCTTCCACGA.

In tumor 7, a spindle cell lipoma carrying der(1)t(1;8) (p31;q11∼12) and der(8)t(1;8)(p?32∼33;q11∼12) chromosome abnormalities, the analysis of raw RNA sequencing data with FusionCatcher detected two fusion transcripts between SDCBP and PLAG1. In the first transcript, exon 2 of SDCBP from 8q12.1 fused to exon 2 of PLAG1: CTATCCATCTCTCGAAGACTTGAAGGTAGACAAAGT AATTCAG::GTTGCCTCTTGGTGCTGCCTTGGCCGTAT TTGGCACCCAGAAT. In the second transcript, exon 2 of SDCBP from 8q12.1 fused to exon 3 of PLAG1: CTATCCATCTCTCGAAGACTTGAAGGTAGACAAAGT AATTCAG:: ATTGGCCAAAATGGGAAGGATTGGATTC CACTCTCTTCCACGA.

RT-PCR using HNRNPA2B1-46F1 and PLAG1-498R1 primer combination amplified two cDNA fragments (data not shown), which, by cloning and Sanger sequencing, confirmed the HNRNPA2B1::PLAG1 fusion transcripts detected by the RNA sequencing/FusionCatcher analysis (Figure 3A). RT-PCR with SDCBP-31F and PLAG1-498R1 primers amplified two cDNA fragments (data not shown). Their cloning and Sanger sequencing confirmed the SDCBP::PLAG1 fusion transcripts detected by RNA sequencing/FusionCatcher (Figure 3B).

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

Sanger sequencing of lipomatous tumors. (A) Partial sequence chromatograms showing the junction between HNRNPA2B1 and PLAG1. (B) Partial sequence chromatograms showing the junction between SDCBP and PLAG1.

Discussion

Our data support the notion that some lipomatous tumors in adults are genetically characterized by aberrations targeting chromosome bands 8q11-13, leading to rearrangement of the PLAG1 gene with generation of a PLAG1 chimera. The G-banding analysis in the 7 tumors described in this study showed involvement of 8q11-13 in a two- or three-way, balanced or unbalanced translocations. In tumors 2, 3 and 4, FISH analyses using a PLAG1 break-apart probe showed a split signal indicating rearrangement of the gene. In two others from which material was available, RNA sequencing and additional molecular studies confirmed the presence of chimeras in which PLAG1 constitutes the 3′-end of a novel fusion gene: tumors 6 and 7 carried HNRNPA2B1::PLAG1 and SDCBP::PLAG1 fusion transcripts, respectively. In both chimeras, the fusion points were in the 5′-end, non-coding regions of the genes. As a consequence, the coding sequence of PLAG1 came under promoter control of the ubiquitously expressed HNRNPA2B1 or SDCBP (46-49). HNRNPA2B1 codes for a member of the A/B subfamily of heterogeneous nuclear ribonucleoproteins (50). Both HNRNPA2B1 and HNRNPA1 are abundant proteins within the 40S ribonucleoprotein complex (50). SDCBP (also known as melanoma differentiation associated gene-9 and syntenin-1) codes for a multifunctional protein which interacts with a number of other proteins and is implicated in protein trafficking, cell adhesion, cytoskeletal-membrane organization, and regulation of transcription factors (51, 52).

PLAG1 on 8q12.1 is transcribed from telomere to centromere whereas both HNRNPA2B1 on 7p15.2 and SDCBP on 8q12.1 are transcribed from centromere to telomere. The orientation of the three genes and the location of SDCBP indicate that: a) the cytogenetically visible translocations of tumors 6 and 7 are not alone sufficient to generate the PLAG1-chimeras, and b) sub-microscopic inversions or insertions probably exist contributing to the generation of chimeras.

Apart from pleomorphic adenomas and lipoblastomas, PLAG1-chimeras have also been reported in neoplasms, such as uterine myxoid leiomyosarcoma (6, 53), chondroid syringoma (8), pediatric fibromyxoid tumor (11, 54), carcinoma ex pleomorphic adenoma (55), acute myeloid leukemia (56, 57), myoepithelioma/myoepithelial carcinoma/mixed tumors (58, 59), and other soft tissue tumors (10, 60). Correspondingly, identical PLAG1-fusion genes were found in different tumor types. For example, TRPS1::PLAG1 was reported in soft tissue myoepithelial tumor, uterine myxoid leiomyosarcoma, and chondroid syringoma (6, 8, 59), YWHAZ::PLAG1 was found in lipoblastoma and pediatric fibromyxoid tumor (17, 54), and so on. All this indicates that the PLAG1 rearrangements/fusion genes hit a stem cell capable of both transformation and differentiation in several directions.

The microscopic and histologic appearance of a tumor is mostly what decides the diagnosis and what the tumor is called. In lipomatous tumors, considerable histopathologic overlap exists between lipoblastomas and other fat cell tumors (4, 17-19, 21, 22, 28, 31, 61-71). The detection of specific acquired genomic aberration patterns can increase diagnostic precision considerably, and for the diagnosis of lipoblastoma, the presence in tumor cells of 8q11-13 chromosome aberrations/PLAG1 rearrangement/PLAG1-chimeras has come to play such a role (4, 22, 61). In lipoma-like and hibernoma-like lipoblastomas, Gisselsson et al. (61) found that PLAG1 rearrangement was not restricted to lipoblasts only but could be found also in other mesenchymal cell components, i.e., in mature adipocytes, stellate primitive mesenchymal cells and fibroblast-like cells. On the other hand, PLAG1 was not rearranged in the vascular elements, endothelial cells, and leukocytes within the tumor (61).

Conclusion

In summary, our present data as well as findings in previously published studies show that 8q11-13 aberrations/PLAG1-rearrangements/PLAG1-chimeras may be detected in various histological type lipomatous tumors that have hitherto been reported as lipomas, spindle cell/pleomorphic lipomas, atypical lipomas/well differentiated liposarcomas, lipoblastomas, and hibernomas (17, 18, 21-31). We are of the opinion that a term, such as “8q11-13/PLAG1-rearranged lipomatous tumors”, may be appropriate for these lipogenic neoplasms, underscoring the common pathogenetic mechanism they may share.

Acknowledgements

This work was supported by grants from Radiumhospitalets Legater.

Footnotes

  • Conflicts of Interest

    The Authors declare that they have no potential conflicts of interest in regard to this study.

  • Authors’ Contributions

    IP designed and supervised the research, performed molecular genetic experiments and bioinformatics analysis, and wrote the article. LG performed the cytogenetic analysis. KA performed molecular genetics and FISH experiments and evaluated the data. ML-I and IL performed the pathological examination. FM evaluated the data. SH evaluated the cytogenetic data and assisted in the writing of the article. All Authors read and approved of the final manuscript.

  • Received December 14, 2022.
  • Revision received January 4, 2023.
  • Accepted January 17, 2023.
  • Copyright © 2023 The Author(s). Published by the International Institute of Anticancer Research.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).

References

  1. ↵
    1. Kas K,
    2. Voz ML,
    3. Röijer E,
    4. Aström AK,
    5. Meyen E,
    6. Stenman G and
    7. Van de Ven WJ
    : Promoter swapping between the genes for a novel zinc finger protein and beta-catenin in pleiomorphic adenomas with t(3;8)(p21;q12) translocations. Nat Genet 15(2): 170-174, 1997. PMID: 9020842. DOI: 10.1038/ng0297-170
    OpenUrlCrossRefPubMed
  2. ↵
    1. Voz ML,
    2. Aström AK,
    3. Kas K,
    4. Mark J,
    5. Stenman G and
    6. Van de Ven WJ
    : The recurrent translocation t(5;8)(p13;q12) in pleomorphic adenomas results in upregulation of PLAG1 gene expression under control of the LIFR promoter. Oncogene 16(11): 1409-1416, 1998. PMID: 9525740. DOI: 10.1038/sj.onc.1201660
    OpenUrlCrossRefPubMed
  3. ↵
    1. Aström AK,
    2. Voz ML,
    3. Kas K,
    4. Röijer E,
    5. Wedell B,
    6. Mandahl N,
    7. Van de Ven W,
    8. Mark J and
    9. Stenman G
    : Conserved mechanism of PLAG1 activation in salivary gland tumors with and without chromosome 8q12 abnormalities: identification of SII as a new fusion partner gene. Cancer Res 59(4): 918-923, 1999. PMID: 10029085.
    OpenUrlAbstract/FREE Full Text
  4. ↵
    1. Hibbard MK,
    2. Kozakewich HP,
    3. Dal Cin P,
    4. Sciot R,
    5. Tan X,
    6. Xiao S and
    7. Fletcher JA
    : PLAG1 fusion oncogenes in lipoblastoma. Cancer Res 60(17): 4869-4872, 2000. PMID: 10987300.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    1. Yoshida H,
    2. Miyachi M,
    3. Ouchi K,
    4. Kuwahara Y,
    5. Tsuchiya K,
    6. Iehara T,
    7. Konishi E,
    8. Yanagisawa A and
    9. Hosoi H
    : Identification of COL3A1 and RAB2A as novel translocation partner genes of PLAG1 in lipoblastoma. Genes Chromosomes Cancer 53(7): 606-611, 2014. PMID: 24700772. DOI: 10.1002/gcc.22170
    OpenUrlCrossRefPubMed
  6. ↵
    1. Arias-Stella JA , 3rd,
    2. Benayed R,
    3. Oliva E,
    4. Young RH,
    5. Hoang LN,
    6. Lee CH,
    7. Jungbluth AA,
    8. Frosina D,
    9. Soslow RA,
    10. Antonescu CR,
    11. Ladanyi M and
    12. Chiang S
    : Novel PLAG1 gene rearrangement distinguishes a subset of uterine myxoid leiomyosarcoma from other uterine myxoid mesenchymal tumors. Am J Surg Pathol 43(3): 382-388, 2019. PMID: 30489320. DOI: 10.1097/PAS.0000000000001196
    OpenUrlCrossRefPubMed
  7. ↵
    1. Wang G,
    2. Guzman MA and
    3. Batanian JR
    : Three novel aberrations involving PLAG1 leading to lipoblastoma in three different patients: High amplification, partial deletion, and a unique complex rearrangement. Cytogenet Genome Res 159(2): 81-87, 2019. PMID: 31614359. DOI: 10.1159/000503158
    OpenUrlCrossRefPubMed
  8. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Andersen K,
    4. Lund-Iversen M,
    5. Lobmaier I,
    6. Micci F and
    7. Heim S
    : NDRG1-PLAG1 and TRPS1-PLAG1 fusion genes in chondroid syringoma. Cancer Genomics Proteomics 17(3): 237-248, 2020. PMID: 32345665. DOI: 10.21873/cgp.20184
    OpenUrlAbstract/FREE Full Text
  9. ↵
    1. Krsková L,
    2. Němečková T,
    3. Balko J,
    4. Brož P and
    5. Vícha A
    : Novel ZEB2-PLAG1 fusion gene identified by RNA sequencing in a case of lipoblastoma. Pediatr Blood Cancer 68(3): e28691, 2021. PMID: 32918527. DOI: 10.1002/pbc.28691
    OpenUrlCrossRefPubMed
  10. ↵
    1. Logan SJ,
    2. Schieffer KM,
    3. Conces MR,
    4. Stonerock E,
    5. Miller AR,
    6. Fitch J,
    7. LaHaye S,
    8. Voytovich K,
    9. McGrath S,
    10. Magrini V,
    11. White P,
    12. Wilson RK,
    13. Mardis ER,
    14. Cottrell CE and
    15. Koo SC
    : Novel morphologic findings in PLAG1-rearranged soft tissue tumors. Genes Chromosomes Cancer 60(8): 577-585, 2021. PMID: 33893698. DOI: 10.1002/gcc.22953
    OpenUrlCrossRefPubMed
  11. ↵
    1. Santisukwongchote S,
    2. Thorner PS,
    3. Desudchit T,
    4. Techavichit P,
    5. Jittapiromsak N,
    6. Amornfa J,
    7. Shuangshoti S,
    8. Shuangshoti S and
    9. Teerapakpinyo C
    : Pediatric fibromyxoid tumor with PLAG1 fusion: An emerging entity with a novel intracranial location. Neuropathology 42(4): 315-322, 2022. PMID: 35723650. DOI: 10.1111/neup.12837
    OpenUrlCrossRefPubMed
  12. ↵
    1. Declercq J,
    2. Van Dyck F,
    3. Braem CV,
    4. Van Valckenborgh IC,
    5. Voz M,
    6. Wassef M,
    7. Schoonjans L,
    8. Van Damme B,
    9. Fiette L and
    10. Van de Ven WJ
    : Salivary gland tumors in transgenic mice with targeted PLAG1 proto-oncogene overexpression. Cancer Res 65(11): 4544-4553, 2005. PMID: 15930271. DOI: 10.1158/0008-5472.CAN-04-4041
    OpenUrlAbstract/FREE Full Text
    1. Declercq J,
    2. Van Dyck F,
    3. Van Damme B and
    4. Van de Ven WJ
    : Upregulation of Igf and Wnt signalling associated genes in pleomorphic adenomas of the salivary glands in PLAG1 transgenic mice. Int J Oncol 32(5): 1041-1047, 2008. PMID: 18425330.
    OpenUrlCrossRefPubMed
    1. Juma AR,
    2. Damdimopoulou PE,
    3. Grommen SV,
    4. Van de Ven WJ and
    5. De Groef B
    : Emerging role of PLAG1 as a regulator of growth and reproduction. J Endocrinol 228(2): R45-R56, 2016. PMID: 26577933. DOI: 10.1530/JOE-15-0449
    OpenUrlCrossRefPubMed
    1. Voz ML,
    2. Agten NS,
    3. Van de Ven WJ and
    4. Kas K
    : PLAG1, the main translocation target in pleomorphic adenoma of the salivary glands, is a positive regulator of IGF-II. Cancer Res 60(1): 106-113, 2000. PMID: 10646861.
    OpenUrlAbstract/FREE Full Text
  13. ↵
    1. Voz ML,
    2. Mathys J,
    3. Hensen K,
    4. Pendeville H,
    5. Van Valckenborgh I,
    6. Van Huffel C,
    7. Chavez M,
    8. Van Damme B,
    9. De Moor B,
    10. Moreau Y and
    11. Van de Ven WJ
    : Microarray screening for target genes of the proto-oncogene PLAG1. Oncogene 23(1): 179-191, 2004. PMID: 14712223. DOI: 10.1038/sj.onc.1207013
    OpenUrlCrossRefPubMed
  14. ↵
    1. Fritchie K,
    2. Wang L,
    3. Yin Z,
    4. Nakitandwe J,
    5. Hedges D,
    6. Horvai A,
    7. Mora JT,
    8. Folpe AL and
    9. Bahrami A
    : Lipoblastomas presenting in older children and adults: analysis of 22 cases with identification of novel PLAG1 fusion partners. Mod Pathol 34(3): 584-591, 2021. PMID: 33097826. DOI: 10.1038/s41379-020-00696-4
    OpenUrlCrossRefPubMed
  15. ↵
    1. Brčić I,
    2. Igrec J,
    3. Halbwedl I,
    4. Viertler C and
    5. Liegl-Atzwanger B
    : Expanding the spectrum of PLAG1-rearranged lipoblastomas arising in patients over 45, with identification of novel fusion partners. Mod Pathol 35(2): 283-285, 2022. PMID: 34400796. DOI: 10.1038/s41379-021-00888-6
    OpenUrlCrossRefPubMed
  16. ↵
    1. Ameloot E,
    2. Cordier F,
    3. Van Dorpe J and
    4. Creytens D
    : Update of pediatric lipomatous lesions: a clinicopathological, immunohistochemical and molecular overview. J Clin Med 11(7): 1938, 2022. PMID: 35407546. DOI: 10.3390/jcm11071938
    OpenUrlCrossRefPubMed
  17. ↵
    1. Thway K
    : What’s new in adipocytic neoplasia? Histopathology 80(1): 76-97, 2022. PMID: 34958506. DOI: 10.1111/his.14548
    OpenUrlCrossRefPubMed
  18. ↵
    1. Sciot R,
    2. De Wever I and
    3. Debiec-Rychter M
    : Lipoblastoma in a 23-year-old male: distinction from atypical lipomatous tumor using cytogenetic and fluorescence in-situ hybridization analysis. Virchows Arch 442(5): 468-471, 2003. PMID: 12684772. DOI: 10.1007/s00428-003-0799-x
    OpenUrlCrossRefPubMed
  19. ↵
    1. de Saint Aubain Somerhausen N,
    2. Coindre JM,
    3. Debiec-Rychter M,
    4. Delplace J and
    5. Sciot R
    : Lipoblastoma in adolescents and young adults: report of six cases with FISH analysis. Histopathology 52(3): 294-298, 2008. PMID: 18269579. DOI: 10.1111/j.1365-2559.2007.02954.x
    OpenUrlCrossRefPubMed
  20. ↵
    1. Pereira-Lourenço MJ,
    2. Vieira-Brito D,
    3. Peralta JP and
    4. Castelo-Branco N
    : Intrascrotal lipoblastoma in adulthood. BMJ Case Rep 12(12): e231320, 2019. PMID: 31826903. DOI: 10.1136/bcr-2019-231320
    OpenUrlCrossRefPubMed
  21. ↵
    1. Sreekantaiah C,
    2. Leong SP,
    3. Karakousis CP,
    4. McGee DL,
    5. Rappaport WD,
    6. Villar HV,
    7. Neal D,
    8. Fleming S,
    9. Wankel A and
    10. Herrington PN
    : Cytogenetic profile of 109 lipomas. Cancer Res 51(1): 422-433, 1991. PMID: 1988102.
    OpenUrlAbstract/FREE Full Text
    1. Dal Cin P,
    2. Kools P,
    3. Sciot R,
    4. De Wever I,
    5. Van Damme B,
    6. Van de Ven W and
    7. Van den Berghe H
    : Cytogenetic and fluorescence in situ hybridization investigation of ring chromosomes characterizing a specific pathologic subgroup of adipose tissue tumors. Cancer Genet Cytogenet 68(2): 85-90, 1993. PMID: 8353809. DOI: 10.1016/0165-4608(93)90001-3
    OpenUrlCrossRefPubMed
    1. Mandahl N,
    2. Akerman M,
    3. Aman P,
    4. Dal Cin P,
    5. De Wever I,
    6. Fletcher CD,
    7. Mertens F,
    8. Mitelman F,
    9. Rosai J,
    10. Rydholm A,
    11. Sciot R,
    12. Tallini G,
    13. Van den Berghe H,
    14. Van de Ven W,
    15. Vanni R and
    16. Willén H
    : Duplication of chromosome segment 12q15-24 is associated with atypical lipomatous tumors: a report of the CHAMP collaborative study group. CHromosomes And MorPhology. Int J Cancer 67(5): 632-635, 1996. PMID: 8782650. DOI: 10.1002/(SICI)1097-0215(19960904)67:5<632::AID-IJC7>3.0.CO;2-V
    OpenUrlCrossRefPubMed
    1. Mandahl N,
    2. Mertens F,
    3. Willén H,
    4. Rydholm A,
    5. Kreicbergs A and
    6. Mitelman F
    : Nonrandom pattern of telomeric associations in atypical lipomatous tumors with ring and giant marker chromosomes. Cancer Genet Cytogenet 103(1): 25-34, 1998. PMID: 9595041. DOI: 10.1016/s0165-4608(97)00268-9
    OpenUrlCrossRefPubMed
  22. ↵
    1. Brandal P,
    2. Bjerkehagen B and
    3. Heim S
    : Rearrangement of chromosomal region 8q11-13 in lipomatous tumours: correlation with lipoblastoma morphology. J Pathol 208(3): 388-394, 2006. PMID: 16308870. DOI: 10.1002/path.1879
    OpenUrlCrossRefPubMed
  23. ↵
    1. Bartuma H,
    2. Hallor KH,
    3. Panagopoulos I,
    4. Collin A,
    5. Rydholm A,
    6. Gustafson P,
    7. Bauer HC,
    8. Brosjö O,
    9. Domanski HA,
    10. Mandahl N and
    11. Mertens F
    : Assessment of the clinical and molecular impact of different cytogenetic subgroups in a series of 272 lipomas with abnormal karyotype. Genes Chromosomes Cancer 46(6): 594-606, 2007. PMID: 17370328. DOI: 10.1002/gcc.20445
    OpenUrlCrossRefPubMed
    1. Bartuma H,
    2. Nord KH,
    3. Macchia G,
    4. Isaksson M,
    5. Nilsson J,
    6. Domanski HA,
    7. Mandahl N and
    8. Mertens F
    : Gene expression and single nucleotide polymorphism array analyses of spindle cell lipomas and conventional lipomas with 13q14 deletion. Genes Chromosomes Cancer 50(8): 619-632, 2011. PMID: 21563233. DOI: 10.1002/gcc.20884
    OpenUrlCrossRefPubMed
  24. ↵
    1. Nishio J,
    2. Iwasaki H,
    3. Nabeshima K,
    4. Kamachi Y and
    5. Naito M
    : Atypical lipomatous tumor with structural rearrangements involving chromosomes 3 and 8. Anticancer Res 34(6): 3073-3076, 2014. PMID: 24922675.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Lund-Iversen M,
    4. Andersen K,
    5. Andersen HK,
    6. Lobmaier I,
    7. Bjerkehagen B and
    8. Heim S
    : Cytogenetics of spindle cell/pleomorphic lipomas: Karyotyping and FISH analysis of 31 tumors. Cancer Genomics Proteomics 15(3): 193-200, 2018. PMID: 29695401. DOI: 10.21873/cgp.20077
    OpenUrlAbstract/FREE Full Text
  26. ↵
    1. Swansbury J
    1. Polito P,
    2. Dal Cin P,
    3. Debiec-Rychter M and
    4. Hagemeijer A
    : Human Solid Tumors. In: Cancer Cytogenetics: Methods and Protocols. Swansbury J (ed.). Totowa, NJ, USA, Humana Press, pp. 135-150, 2003.
  27. ↵
    1. Campbell LJ
    1. Lukeis R and
    2. Suter M
    : Cytogenetics of Solid Tumours. In: Cancer Cytogenetics: Methods and Protocols. Campbell LJ (ed.). Totowa, NJ, USA, Humana Press, pp. 173-187, 2011.
  28. ↵
    1. McGowan-Jordan J,
    2. Hastings RJ and
    3. Moore S
    : ISCN 2020: An International System for Human Cytogenetic Nomenclature. Basel, Switzerland, Karger, pp. 140, 2016.
  29. ↵
    1. Roohi J,
    2. Cammer M,
    3. Montagna C and
    4. Hatchwell E
    : An improved method for generating BAC DNA suitable for FISH. Cytogenet Genome Res 121(1): 7-9, 2008. PMID: 18544919. DOI: 10.1159/000124374
    OpenUrlCrossRefPubMed
    1. Panagopoulos I,
    2. Andersen K,
    3. Gorunova L,
    4. Davidson B,
    5. Micci F and
    6. Heim S
    : A novel cryptic t(2;3)(p21;q25) translocation fuses the WWTR1 and PRKCE genes in uterine leiomyoma with 3q-as the sole visible chromosome abnormality. Cancer Genomics Proteomics 19(5): 636-646, 2022. PMID: 35985686. DOI: 10.21873/cgp.20348
    OpenUrlAbstract/FREE Full Text
  30. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Andersen K,
    4. Lund-Iversen M,
    5. Hognestad HR,
    6. Lobmaier I,
    7. Micci F and
    8. Heim S
    : Chromosomal translocation t(5;12)(p13;q14) leading to fusion of high-mobility group AT-hook 2 gene with intergenic sequences from chromosome sub-band 5p13.2 in benign myoid neoplasms of the breast: a second case. Cancer Genomics Proteomics 19(4): 445-455, 2022. PMID: 35732319. DOI: 10.21873/cgp.20331
    OpenUrlAbstract/FREE Full Text
  31. ↵
    1. Nicorici D,
    2. Satalan H,
    3. Edgren H,
    4. Kangaspeska S,
    5. Murumagi A,
    6. Kallioniemi O,
    7. Virtanen S and
    8. Kikku O
    : FusionCatcher - a tool for finding somatic fusion genes in paired-end RNA-sequencing data. bioRxiv, 2014. DOI: DOI:10.1101/011650
    OpenUrlAbstract/FREE Full Text
  32. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Andersen K,
    4. Lobmaier I,
    5. Micci F and
    6. Heim S
    : Fusion of high mobility group AT-hook 2 gene (HMGA2) with the chromosome 12 open reading frame 42 gene (C12orf42) in an aggressive angiomyxoma with del(12)(q14q23) as the sole cytogenetic anomaly. Cancer Genomics Proteomics 19(5): 576-583, 2022. PMID: 35985684. DOI: 10.21873/cgp.20342
    OpenUrlAbstract/FREE Full Text
  33. ↵
    1. Panagopoulos I,
    2. Andersen K,
    3. Gorunova L,
    4. Eilert-Olsen M,
    5. Lund-Iversen M,
    6. Wessel-Aas T,
    7. Lloret I,
    8. Micci F and
    9. Heim S
    : Presence of a t(12;18)(q14;q21) chromosome translocation and fusion of the genes for high-mobility group AT-Hook 2 (HMGA2) and WNT inhibitory factor 1 (WIF1) in infrapatellar fat pad cells from a patient with Hoffa’s disease. Cancer Genomics Proteomics 19(5): 584-590, 2022. PMID: 35985683. DOI: 10.21873/cgp.20343
    OpenUrlAbstract/FREE Full Text
  34. ↵
    1. Singhal H,
    2. Ren YR and
    3. Kern SE
    : Improved DNA electrophoresis in conditions favoring polyborates and lewis acid complexation. PLoS One 5(6): e11318, 2010. PMID: 20593002. DOI: 10.1371/journal.pone.0011318
    OpenUrlCrossRefPubMed
  35. ↵
    1. Altschul SF,
    2. Gish W,
    3. Miller W,
    4. Myers EW and
    5. Lipman DJ
    : Basic local alignment search tool. J Mol Biol 215(3): 403-410, 1990. PMID: 2231712. DOI: 10.1016/S0022-2836(05)80360-2
    OpenUrlCrossRefPubMed
  36. ↵
    1. Kent WJ
    : BLAT—the BLAST-like alignment tool. Genome Res 12(4): 656-664, 2002. PMID: 11932250. DOI: 10.1101/gr.229202
    OpenUrlAbstract/FREE Full Text
  37. ↵
    1. Kent WJ,
    2. Sugnet CW,
    3. Furey TS,
    4. Roskin KM,
    5. Pringle TH,
    6. Zahler AM and
    7. Haussler D
    : The human genome browser at UCSC. Genome Res 12(6): 996-1006, 2002. PMID: 12045153. DOI: 10.1101/gr.229102
    OpenUrlAbstract/FREE Full Text
  38. ↵
    1. Biamonti G,
    2. Ruggiu M,
    3. Saccone S,
    4. Della Valle G and
    5. Riva S
    : Two homologous genes, originated by duplication, encode the human hnRNP proteins A2 and A1. Nucleic Acids Res 22(11): 1996-2002, 1994. PMID: 8029005. DOI: 10.1093/nar/22.11.1996
    OpenUrlCrossRefPubMed
    1. Kamma H,
    2. Portman DS and
    3. Dreyfuss G
    : Cell type-specific expression of hnRNP proteins. Exp Cell Res 221(1): 187-196, 1995. PMID: 7589244. DOI: 10.1006/excr.1995.1366
    OpenUrlCrossRefPubMed
    1. Kozu T,
    2. Henrich B and
    3. Schäfer KP
    : Structure and expression of the gene (HNRPA2B1) encoding the human hnRNP protein A2/B1. Genomics 25(2): 365-371, 1995. PMID: 7789969. DOI: 10.1016/0888-7543(95)80035-k
    OpenUrlCrossRefPubMed
  39. ↵
    1. Borrell-Pagès M,
    2. Fernández-Larrea J,
    3. Borroto A,
    4. Rojo F,
    5. Baselga J and
    6. Arribas J
    : The carboxy-terminal cysteine of the tetraspanin L6 antigen is required for its interaction with SITAC, a novel PDZ protein. Mol Biol Cell 11(12): 4217-4225, 2000. PMID: 11102519. DOI: 10.1091/mbc.11.12.4217
    OpenUrlAbstract/FREE Full Text
  40. ↵
    1. Thibault PA,
    2. Ganesan A,
    3. Kalyaanamoorthy S,
    4. Clarke JWE,
    5. Salapa HE and
    6. Levin MC
    : hnRNP A/B proteins: an encyclopedic assessment of their roles in homeostasis and disease. Biology (Basel) 10(8): 712, 2021. PMID: 34439945. DOI: 10.3390/biology10080712
    OpenUrlCrossRefPubMed
  41. ↵
    1. Philley JV,
    2. Kannan A and
    3. Dasgupta S
    : MDA-9/syntenin control. J Cell Physiol 231(3): 545-550, 2016. PMID: 26291527. DOI: 10.1002/jcp.25136
    OpenUrlCrossRefPubMed
  42. ↵
    1. Shimada T,
    2. Yasuda S,
    3. Sugiura H and
    4. Yamagata K
    : Syntenin: PDZ protein regulating signaling pathways and cellular functions. Int J Mol Sci 20(17): 4171, 2019. PMID: 31454940. DOI: 10.3390/ijms20174171
    OpenUrlCrossRefPubMed
  43. ↵
    1. Thiryayi SA,
    2. Turashvili G,
    3. Latta EK,
    4. Swanson D,
    5. Zhang L,
    6. Antonescu CR and
    7. Dickson BC
    : PLAG1-rearrangment in a uterine leiomyosarcoma with myxoid stroma and heterologous differentiation. Genes Chromosomes Cancer 60(10): 713-717, 2021. PMID: 34184333. DOI: 10.1002/gcc.22980
    OpenUrlCrossRefPubMed
  44. ↵
    1. Chung CT,
    2. Antonescu CR,
    3. Dickson BC,
    4. Chami R,
    5. Marrano P,
    6. Fan R,
    7. Shago M,
    8. Hameed M and
    9. Thorner PS
    : Pediatric fibromyxoid soft tissue tumor with PLAG1 fusion: A novel entity? Genes Chromosomes Cancer 60(4): 263-271, 2021. PMID: 33300192. DOI: 10.1002/gcc.22926
    OpenUrlCrossRefPubMed
  45. ↵
    1. Katabi N,
    2. Ghossein R,
    3. Ho A,
    4. Dogan S,
    5. Zhang L,
    6. Sung YS and
    7. Antonescu CR
    : Consistent PLAG1 and HMGA2 abnormalities distinguish carcinoma ex-pleomorphic adenoma from its de novo counterparts. Hum Pathol 46(1): 26-33, 2015. PMID: 25439740. DOI: 10.1016/j.humpath.2014.08.017
    OpenUrlCrossRefPubMed
  46. ↵
    1. Aypar U,
    2. Yao J,
    3. Londono DM,
    4. Khoobyar R,
    5. Scalise A,
    6. Arcila ME,
    7. Roshal M,
    8. Xiao W and
    9. Zhang Y
    : Rare and novel RUNX1 fusions in myeloid neoplasms: A single-institute experience. Genes Chromosomes Cancer 60(2): 100-107, 2021. PMID: 33078873. DOI: 10.1002/gcc.22901
    OpenUrlCrossRefPubMed
  47. ↵
    1. Kerbs P,
    2. Vosberg S,
    3. Krebs S,
    4. Graf A,
    5. Blum H,
    6. Swoboda A,
    7. Batcha AMN,
    8. Mansmann U,
    9. Metzler D,
    10. Heckman CA,
    11. Herold T and
    12. Greif PA
    : Fusion gene detection by RNA-sequencing complements diagnostics of acute myeloid leukemia and identifies recurring NRIP1-MIR99AHG rearrangements. Haematologica 107(1): 100-111, 2022. PMID: 34134471. DOI: 10.3324/haematol.2021.278436
    OpenUrlCrossRefPubMed
  48. ↵
    1. Antonescu CR,
    2. Zhang L,
    3. Shao SY,
    4. Mosquera JM,
    5. Weinreb I,
    6. Katabi N and
    7. Fletcher CD
    : Frequent PLAG1 gene rearrangements in skin and soft tissue myoepithelioma with ductal differentiation. Genes Chromosomes Cancer 52(7): 675-682, 2013. PMID: 23630011. DOI: 10.1002/gcc.22063
    OpenUrlCrossRefPubMed
  49. ↵
    1. Zhu G,
    2. Benayed R,
    3. Ho C,
    4. Mullaney K,
    5. Sukhadia P,
    6. Rios K,
    7. Berry R,
    8. Rubin BP,
    9. Nafa K,
    10. Wang L,
    11. Klimstra DS,
    12. Ladanyi M and
    13. Hameed MR
    : Diagnosis of known sarcoma fusions and novel fusion partners by targeted RNA sequencing with identification of a recurrent ACTB-FOSB fusion in pseudomyogenic hemangioendothelioma. Mod Pathol 32(5): 609-620, 2019. PMID: 30459475. DOI: 10.1038/s41379-018-0175-7
    OpenUrlCrossRefPubMed
  50. ↵
    1. Tomás-Velázquez A,
    2. Surrey LF,
    3. Miele E,
    4. Li MM,
    5. Alaggio R,
    6. Goitz RJ,
    7. Reyes-Múgica M and
    8. Salgado CM
    : Mesenchymal PLAG1 tumor with PCMTD1-PLAG1 fusion in an infant: a new type of “Plagoma”. Am J Dermatopathol 44(1): 54-57, 2022. PMID: 34291746. DOI: 10.1097/DAD.0000000000001978
    OpenUrlCrossRefPubMed
  51. ↵
    1. Gisselsson D,
    2. Hibbard MK,
    3. Dal Cin P,
    4. Sciot R,
    5. Hsi BL,
    6. Kozakewich HP and
    7. Fletcher JA
    : PLAG1 alterations in lipoblastoma: involvement in varied mesenchymal cell types and evidence for alternative oncogenic mechanisms. Am J Pathol 159(3): 955-962, 2001. PMID: 11549588. DOI: 10.1016/S0002-9440(10)61771-3
    OpenUrlCrossRefPubMed
    1. Kuhnen C,
    2. Mentzel T,
    3. Fisseler-Eckhoff A,
    4. Debiec-Rychter M and
    5. Sciot R
    : Atypical lipomatous tumor in a 14-year-old patient: distinction from lipoblastoma using FISH analysis. Virchows Arch 441(3): 299-302, 2002. PMID: 12242528. DOI: 10.1007/s00428-002-0690-1
    OpenUrlCrossRefPubMed
    1. Coffin CM,
    2. Lowichik A and
    3. Putnam A
    : Lipoblastoma (LPB): a clinicopathologic and immunohistochemical analysis of 59 cases. Am J Surg Pathol 33(11): 1705-1712, 2009. PMID: 19738456. DOI: 10.1097/PAS.0b013e3181b76462
    OpenUrlCrossRefPubMed
    1. Morerio C,
    2. Nozza P,
    3. Tassano E,
    4. Rosanda C,
    5. Granata C,
    6. Conte M and
    7. Panarello C
    : Differential diagnosis of lipoma-like lipoblastoma. Pediatr Blood Cancer 52(1): 132-134, 2009. PMID: 18798558. DOI: 10.1002/pbc.21747
    OpenUrlCrossRefPubMed
    1. Nagano A,
    2. Ohno T,
    3. Nishimoto Y,
    4. Hirose Y,
    5. Miyake S and
    6. Shimizu K
    : Lipoblastoma mimicking myxoid liposarcoma: a clinical report and literature review. Tohoku J Exp Med 223(1): 75-78, 2011. PMID: 21212605. DOI: 10.1620/tjem.223.75
    OpenUrlCrossRefPubMed
    1. Xu Y,
    2. Ogose A,
    3. Ariizumi T,
    4. Kawashima H,
    5. Hotta T,
    6. Li G,
    7. Umezu H and
    8. Endo N
    : Lipoma-like lipoblastoma arising from the femoral vein. J Orthop Sci 16(1): 114-118, 2011. PMID: 21249406. DOI: 10.1007/s00776-010-0001-7
    OpenUrlCrossRefPubMed
    1. Pedeutour F,
    2. Deville A,
    3. Steyaert H,
    4. Ranchere-Vince D,
    5. Ambrosetti D and
    6. Sirvent N
    : Rearrangement of HMGA2 in a case of infantile lipoblastoma without Plag1 alteration. Pediatr Blood Cancer 58(5): 798-800, 2012. PMID: 22223189. DOI: 10.1002/pbc.23335
    OpenUrlCrossRefPubMed
    1. Hisaoka M
    : Lipoblast: morphologic features and diagnostic value. J UOEH 36(2): 115-121, 2014. PMID: 24930875. DOI: 10.7888/juoeh.36.115
    OpenUrlCrossRefPubMed
    1. Michal M,
    2. Kazakov DV,
    3. Hadravsky L,
    4. Michalova K,
    5. Grossmann P,
    6. Steiner P,
    7. Vanecek T,
    8. Renda V,
    9. Suster S and
    10. Michal M
    : Lipoblasts in spindle cell and pleomorphic lipomas: a close scrutiny. Hum Pathol 65: 140-146, 2017. PMID: 28546131. DOI: 10.1016/j.humpath.2017.05.006
    OpenUrlCrossRefPubMed
    1. Gerhard-Hartmann E,
    2. Vokuhl C,
    3. Roth S,
    4. Steinmüller T,
    5. Rosenfeldt M,
    6. Zamò A,
    7. Rosenwald A,
    8. Appenzeller S,
    9. Ernestus K and
    10. Maurus K
    : The histological and molecular spectrum of lipoblastoma: A case series with identification of three novel gene fusions by targeted RNA-sequencing. Pathol Res Pract 226: 153591, 2021. PMID: 34455363. DOI: 10.1016/j.prp.2021.153591
    OpenUrlCrossRefPubMed
  52. ↵
    1. Yergin CG,
    2. Chang M and
    3. Thomas RM
    : When is a lipoma not a lipoma? Case report presenting a lipoblastoma-like tumor of the gluteal cleft in an older gentleman with literature review. Int J Surg Case Rep 92: 106889, 2022. PMID: 35245849. DOI: 10.1016/j.ijscr.2022.106889
    OpenUrlCrossRefPubMed
PreviousNext
Back to top

In this issue

Cancer Genomics - Proteomics: 20 (2)
Cancer Genomics & Proteomics
Vol. 20, Issue 2
March-April 2023
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover
  • Index by author
  • Back Matter (PDF)
  • Ed Board (PDF)
  • Front Matter (PDF)
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word on Cancer Genomics & Proteomics.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Recurrent 8q11-13 Aberrations Leading to PLAG1 Rearrangements, Including Novel Chimeras HNRNPA2B1::PLAG1 and SDCBP::PLAG1, in Lipomatous Tumors
(Your Name) has sent you a message from Cancer Genomics & Proteomics
(Your Name) thought you would like to see the Cancer Genomics & Proteomics web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
2 + 7 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Citation Tools
Recurrent 8q11-13 Aberrations Leading to PLAG1 Rearrangements, Including Novel Chimeras HNRNPA2B1::PLAG1 and SDCBP::PLAG1, in Lipomatous Tumors
IOANNIS PANAGOPOULOS, KRISTIN ANDERSEN, LUDMILA GORUNOVA, MARIUS LUND-IVERSEN, INGVILD LOBMAIER, FRANCESCA MICCI, SVERRE HEIM
Cancer Genomics & Proteomics Mar 2023, 20 (2) 171-181; DOI: 10.21873/cgp.20372

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Reprints and Permissions
Share
Recurrent 8q11-13 Aberrations Leading to PLAG1 Rearrangements, Including Novel Chimeras HNRNPA2B1::PLAG1 and SDCBP::PLAG1, in Lipomatous Tumors
IOANNIS PANAGOPOULOS, KRISTIN ANDERSEN, LUDMILA GORUNOVA, MARIUS LUND-IVERSEN, INGVILD LOBMAIER, FRANCESCA MICCI, SVERRE HEIM
Cancer Genomics & Proteomics Mar 2023, 20 (2) 171-181; DOI: 10.21873/cgp.20372
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Conclusion
    • Acknowledgements
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

  • No citing articles found.
  • Google Scholar

More in this TOC Section

  • Receptor for Hyaluronic Acid-mediated Motility (RHAMM) Is Associated With Prostate Cancer Migration and Poor Prognosis
  • Oncogenes and Methionine Addiction of Cancer: Role of c-MYC
  • An miRNA Signature Predicts Grading of Pancreatic Neuroendocrine Neoplasms
Show more Article

Keywords

  • Chromosome band 8q11-13
  • pleomorphic adenoma gene 1
  • PLAG1 fusion genes
  • HNRNPA2B1::PLAG1
  • SDCBP::PLAG1
  • lipoma
  • lipoblastoma
  • lipomatous tumors
Cancer & Genome Proteomics

© 2026 Cancer Genomics & Proteomics

Powered by HighWire