Abstract
Background/Aim: T-cell acute lymphoblastic leukemia (T-ALL) is a rare malignancy characterized by proliferation of early T-cell precursors that replace normal hematopoietic cells. T-ALL cells carry non-random chromosome aberrations, fusion genes, and gene mutations, often of prognostic significance. We herein report the genetic findings in cells from a T-ALL patient. Materials and Methods: Bone marrow cells from a patient with T-ALL were examined using G-banding, array comparative genomic hybridization (aCGH), RNA sequencing, reverse transcription polymerase chain reaction (RT-PCR), Sanger sequencing, and fluorescence in situ hybridization. Results: G-banding revealed del(1)(p34), add(5)(q14), trisomy 8, and monosomy 21 in the leukemic cells. aCGH detected the gross unbalances inferred from the karyotyping results, except that heterozygous loss of chromosome 21 did not include its distal part; 21q22.12-q22.3 was undeleted. In addition, aCGH detected a submicroscopic interstitial 7.56 Mbp deletion in the q arm of chromosome 19 from 19q13.2 to 19q13.33. RNA sequencing detected and RT-PCR/Sanger sequencing confirmed the presence of two novel chimeras, MYCBP::EHD2 and RUNX1::ZNF780A. They were generated from rearrangements involving subbands 1p34.3 (MYCBP), 19q13.2 (ZNF780A), 19q13.33 (EHD2), and 21q22.12 (RUNX1), i.e., at the breakpoints of chromosomal deletions. Conclusion: The leukemic cells showed the heterozygous loss of many genes as well as the generation of MYCBP::EHD2 and RUNX1::ZNF780A chimeras. Because the partner genes in the chimeras were found at the breakpoints of the chromosomal deletions, we believe that both the heterozygous losses and the generation of the two chimeras occurred simultaneously, and that they were pathogenetically important.
- T-cell acute lymphoblastic leukemia
- fusion gene
- cytogenetics
- MYCBP
- EHD2
- RUNX1
- ZNF780A
- MYCBP::EHD2
- RUNX1::ZNF780A
- RNA-sequencing
T-cell acute lymphoblastic leukemia (T-ALL) is a rare malignant disease that accounts for 10-15% of pediatric ALL and 25% of adult ALL. The leukemia is characterized by proliferation of early T-cell precursors replacing the normal hematopoietic cells (1-3). Cytogenetic examination of T-ALL cells has shown that they carry non-random numerical and/or structural chromosome aberrations (this is also typical in other leukemias) that are of diagnostic as well as prognostic importance (4, 5). Molecular investigations of some of these aberrations has led to the identification of recurrent fusion genes (5) and unraveled their role in leukemogenesis. In recent years, utilization of high throughput sequencing technology on T-ALLs has revealed also numerous other fusion genes and gene mutations (6-9). The combined use of high throughput sequencing, mainly transcriptome sequencing, and karyotyping has detected specific fusion genes of unquestionable pathogenetic significance (10-16).
In the present study, we applied the above-mentioned methodological combination on a T-ALL searching for fusion genes.
Materials and Methods
Ethics statement. The study was approved by the regional ethics committee (Regional komité for medisinsk forskningsetikk Sør-Øst, Norge, http://helseforskning.etikkom.no, REK: 19178). Written informed consent was obtained from the patient prior to publication of case details. The ethics committee’s approval included a review of the consent procedure. All patient information has been de-identified.
Case report. The patient was a previously healthy 17-year-old boy, admitted to the hospital due to symptoms of upper respiratory tract infection, dysphagia, and an enlarged supraclavicular lymph node. CT-scan of the thorax revealed a tumour in the anterior mediastinum, measuring nine centimetres in the largest diameter. Biopsies from bone marrow and lymph node confirmed an early precursor T-cell leukaemia. He started treatment according to the ALLTogether protocol (17) [ALLTogether1 – A Treatment study protocol of the ALLTogether Consortium for children and young adults (0-45 years of age) with newly diagnosed acute lymphoblastic leukaemia (ALL)], with a slow response and was stratified to the high-risk group. During his treatment he developed pancreatitis and polyneuropathy. He went through a bone marrow transplantation seven months post-diagnosis and is still in remission 1.5 years later.
G-banding and karyotyping. Bone marrow cells obtained at diagnosis were cytogenetically investigated (18, 19). Chromosome preparations were made from metaphase cells of a 24 h culture; they were G-banded using Leishman stain, and karyotyped according to the guidelines of the international system for human cytogenomic nomenclature (2020) (20).
DNA and RNA isolation and complementary DNA (cDNA) synthesis. Genomic DNA and total RNA were extracted from the patient’s bone marrow samples at diagnosis. DNA was extracted using the Maxwell 16 Instrument System and the Maxwell 16 Cell DNA Purification Kit (Promega, Madison, WI, USA) and the concentration was measured with a Quantus fluorometer (Promega). Total RNA was extracted using the miRNeasy Mini Kit (Qiagen, Hilden, Germany) and the QiaCube automated purification system according to the manufacturer’s instructions (Qiagen); the concentration was measured with the QIAxpert microfluidic UV/VIS spectrophotometer (Qiagen). The Agilent 2100 bioanalyzer and RNA Integrity Number (RIN) were used to assess RNA quality (21). RIN of RNA was 6.6. cDNA was synthesized from one μg of total RNA using the iScript Advanced cDNA Synthesis Kit for RT-qPCR according to the manufacturer’s instructions (Bio-Rad, Hercules, CA, USA). The quality of the cDNA synthesis was assessed by amplification of a cDNA fragment of the ABL protooncogene 1, non-receptor tyrosine kinase (ABL1) gene using the primer combination ABL1-91F1/ABL1-404R1 (Table I) (22, 23).
Designation, sequence (5′->3′), and position in reference sequences of the forward (F) and reverse (R) primers of the genes MYC binding protein (MYCBP), EH domain containing 2 (EHD2), RUNX family transcription factor 1 (RUNX1) and zinc finger protein 780A (ZNF780A), which were used for polymerase chain reaction amplification and Sanger sequencing analyses. For Sanger sequencing analyses the forward primers had the M13 forward primer sequence TGTAAAACGACGGCCAGT at their 5′-end. The reverse primers had the M13 reverse primer sequence CAGGAAACAGCTATGACC at their 5′-end.
Array comparative genomic hybridization (aCGH) analysis. aCGH was performed using the CytoSure array products (Oxford Gene Technology, Begbroke, Oxfordshire, UK) following the company’s protocols (14). The reference DNA was Promega’s human genomic male DNA (Promega). The slides (CytoSure Cancer +SNP array) were scanned in an Agilent SureScan Dx microarray scanner using Agilent Feature Extraction Software (version 12.1.1.1). Data were analyzed using the CytoSure Interpret analysis software (version 4.9.40). Annotations are based on human genome build 19.
RNA sequencing. High-throughput paired-end RNA-sequencing was performed at the Genomics Core Facility, Norwegian Radium Hospital, Oslo University Hospital (http://genomics.no/oslo/). The software FusionCatcher was used to find fusion transcripts (24).
PCR and Sanger sequencing analyses. The primers used for PCR amplification and Sanger sequencing are listed in Table I. The methods involved in PCR amplification and cycle Sanger sequencing have been described in detail in our previous studies (13, 14, 22, 23, 25, 26). Sequence analyses were performed on the Applied Biosystems SeqStudio Genetic Analyzer system (ThermoFisher Scientific). The basic local alignment search tool (BLAST) software (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used for computer analysis of sequence data (27). The BLAT alignment tool and the human genome browser at UCSC were also used to map the sequences on the Human GRCh37/hg19 assembly (28, 29).
Fluorescence in situ hybridization (FISH) analysis. FISH analysis was performed on metaphase plates using in-house prepared probes made from commercially available bacterial artificial chromosomes (BAC), purchased from the BACPAC Resource Center operated by BACPAC Genomics, Emeryville, CA, USA (https://bacpacresources.org/) (Table II). BAC DNAs and labeling of the probes were prepared as previously described (30-32). Probes were labelled with Texas Red-5-dCTP (PerkinElmer, Boston, MA, USA) to obtain a red signal and fluorescein-12-dCTP (PerkinElmer) to obtain a green signal. Chromosome preparations were counterstained with 0.2 μg/ml 4′,6-diamidino-2-phenylindole and overlaid with a 24×50 mm2 coverslip. Fluorescent signals were captured and analyzed using the CytoVision system (Leica Biosystems, Newcastle, UK). Mapping of the clones on normal controls was performed to confirm their chromosomal location (Table II).
BAC probes used for fluorescence in situ hybridization (FISH) experiments in order to detect the MYCBP::EHD2 chimera. The position of the MYCB and EHD2 genes is also given.
Results
Cytogenetics and aCGH analyses. Cytogenetic examination of short-term cultured cells from the patient´s bone marrow revealed a deletion on the p arm of chromosome 1, an addition of extra material of unknown chromosomal origin on the long arm of chromosome 5, a gain of chromosome 8, and loss of one chromosome 21 on 6 out of 10 examined metaphases (Figure 1). Consequently, the karyotype was: 46,XY,del(1)(p34),add(5)(q14),+8,-21[6]/46,XY[4].
G-banding analysis of the bone marrow cells of the T-ALL patient. A karyogram is shown, depicting the chromosome aberrations of the leukemic cells corresponding to the karyotype 46,XY,del(1)(p34),add(5)(q14),+8,-21. Arrows indicate breakpoints.
The results from aCGH are shown in Figure 2, Figure 3, Figure 4, Figure 5 and Figure 6. aCGH confirmed the del(1)(p34), revealing that the breakpoint was in the subband 1p34.3, in the area hosting the genes Ras related GTP binding C (RRAGC), MYC binding protein (MYCBP), gap junction protein alpha 9 (GJA9) and rhomboid like 2 (RHBDL2) (Figure 2, Figure 3A and B). Because there were no probes on MYCBP and GJA9, the breakpoint could not map more precisely (Figure 3B). For chromosome 5, the aCGH analysis showed that the cytogenetically detected add(5)(q14) was accompanied by a deletion which started at 5q14, just downstream of the adhesion G protein-coupled receptor V1 gene (ADGRV1, also known as GRP98) (Figure 2, Figure 4A and B). Besides confirming the cytogenetically observed trisomy for chromosome 8 (Figure 2), aCGH also detected an interstitial deletion in 19q13 (Figure 2 and Figure 5) that started between the zinc finger protein 780A (ZNF780A) and mitogen-activated protein kinase 10 (MAP3K10) genes (Figure 5A and B) and ended in EH domain containing 2 (EHD2) (Figure 5A and C). Because of the low number of probes at the breakpoint regions, the interstitial deletion in 19q13 could not be mapped more precisely (Figure 5B and C). aCGH also showed loss of a large part of chromosome 21 (21p11.2-q22.2) (Figure 2, Figure 6A and B). However, 21q22.12-q22.3, including exons 1 and 2 of RUNX1, was not deleted (Figure 6B).
Array comparative genomic hybridization (aCGH) examination of the bone marrow cells of the T-ALL patient. (A) Genetic profile of whole genome showing trisomy for chromosome 8 and losses from parts of chromosomes 1, 5, 19, and 21. (B) The cytogenetic location, position on GRCh37/hg19 assembly, size (in Mbp), and gain/loss of the genetic imbalances are presented.
aCGH showing the deleted part of the p arm of chromosome 1. (A) Based on the hg19 assembly the deletion ended at position chr1:39311945, on the subband 1p34.3. The most distal (p-telomeric) probe in the assay mapped at position chr1:10478. (B) The area at position chr1:39311945 hosting the genes Ras related GTP binding C (RRAGC), MYC binding protein (MYCBP), gap junction protein alpha 9 (GJA9) and rhomboid like 2 (RHBDL2). Because there were no probes on MYCBP and GJA9, the breakpoint could not map more precisely. Highlights indicate the deleted (loss) part.
aCGH showing the deleted part of the q arm of chromosome 5. (A) The deletion started at position chr5:90488653 on the subband 5q14.3 and ended on subband 5q35.3. The most distal (q-telomeric) probe in the assay mapped at position chr5: 180787863. (B) The area at position chr5:90488653 shows that the deletion is just downstream of the adhesion G protein-coupled receptor V1 gene (ADGRV1, also known as GRP98). Highlights indicate the deleted (loss) part.
aCGH analysis showing the interstitial deletion in q arm of chromosome 19. (A) Genetic profile of whole chromosome 19 showing the deletion started at position Chr19:40662574 on subband 19q13.2 and ended at chr19: 48223904 on subband 19q13.33. (B) The area at position Chr19:40662574 showing that the deletion started between the genes zinc finger protein 780A (ZNF780A) and mitogen-activated protein kinase 10 (MAP3K10). (C) The area at position chr19: 48223904 showing that deletion ended within the EH domain containing 2 (EHD2) gene. Because of the low number of probes at the breakpoint regions, the interstitial deletion in 19q13 could not be mapped more precisely. Highlights indicate the deleted (loss) part.
aCGH analysis showing the deleted part of chromosome 21. (A) The deletion ended at position Chr21: 36299935 on the subband 21q22.13. The most distal probe on the p arm of chromosome 21 in the assay mapped at position Chr21:10773805. (B) The area at position Chr21: 36299935 showing that the deletion ended within intron 2 of RUNX1.
RNA sequencing, RT-PCR, and Sanger sequencing analyses. Analysis of raw sequencing data using FusionCatcher detected two fusion transcripts. The first transcript was a fusion of exon 4 of MYCBP from 1p34.4 (nucleotide 310 in reference sequence NM_012333.5) with exon 5 of EHD2 from 19q13.33 (nucleotide 1088 in reference sequence NM_014601.4): AAGAGAAGTATGAAGCTATTGTAGAAGAAAATAAAAA ACTGAAAGCAAAG::GTTCACGCTTACATCATCAGCTA CCTGAAGAAGGAGATGCCCTCTGTGTT. The second chimeric transcript was a fusion of exon 2 of RUNX1 from 21q22.12 (nucleotide 248 in reference sequence NM_001754.4) with exon 3 of ZNF780A from 19q13.2 (nucleotide 109 in reference sequence NM_001142577.2): AGACAGCATATTTGAGTCATTTCCTTCGTACCCACAGT GCTTCATGAGAG::GGGAGAAGCCCGAGGAAGATTGA CCAGTTTTGTAATTCTAGCAACATGGT.
RT-PCR using the MYCBP-199F1 and EHD2-1197R1 primer combination amplified a 245 bp cDNA fragment which was shown by Sanger sequencing to confirm the MYCBP::EHD2 fusion transcript detected by the RNA sequencing/FusionCatcher analysis (Figure 7A). RT-PCR with RUNX1-155F1 and ZNF780A-199R1 primers amplified a 206 bp fragment, which confirmed (by Sanger sequencing) the RUNX1::ZNF780A fusion transcript detected by the RNA sequencing/FusionCatcher (Figure 7B).
Sanger sequencing and fluorescence in situ hybridization (FISH) of the bone marrow cells of the T-ALL patient. (A) Partial Sanger sequencing chromatogram showing the junction between exon 4 of MYCBP and exon 2 of EHD2. (B) Partial Sanger sequencing chromatogram showing the junction between exon 2 of RUNX1 and exon 3 of ZNF780A. (C) FISH analysis on metaphase plates using in-house prepared probes for the MYCBP (red labeled) and EHD2 (green label) genes showed a red signal corresponding to normal MYCBP on chromosome 1, a green signal on normal chromosome 19 corresponding to EHD2, a fusion red/green signal on der(1) chromosome which corresponded to the MYCBP::EHD2 chimera, and a red signal on der(19) indicating that material from chromosome bad 1p34 translocated to q13 of der(19).
Fluorescence in situ hybridization (FISH) analyses. FISH analysis on metaphase plates using in-house prepared probes for the MYCBP (red labeled) and EHD2 (green label) genes showed a red signal corresponding to a normal MYCBP on chromosome 1, a green signal on normal chromosome 19 corresponding to EHD2, a fusion red/green signal on der(1) chromosome corresponding to a MYCBP::EHD2 chimera, and a red signal on der(19) indicating that material from chromosome band 1p34 had been moved to band q13 of the der(19) (Figure 7C).
Discussion
As a consequence of the chromosomal aberrations, there was heterozygous loss of many genes on chromosomes 1, 5, 19 and 21, due to the del(1)(p34), add(5)(q14), interstitial deletion on 19q, and deletion of a large part of chromosome 21, found by aCGH and/or G-banding. Trisomy 8 was also part of the karyotype; this aberration is common in leukemia(s) both as the sole abnormality and as a secondary change, although its exact role in leukemogenesis remains enigmatic (33-35). In the Mitelman database of chromosome aberrations and gene fusions in cancer (last updated on July 27, 2022), only 245 out of 3225 (7.6%) T-cell lineage acute lymphoblastic leukemia/lymphoblastic lymphoma entries have been reported with +8 in their karyotype. In most of them, the +8 was a secondary aberration (33).
In addition to genomic imbalances, the cytogenetic aberrations also resulted in generation of the MYCBP::EHD2 and RUNX1::ZNF780A chimeras, since the partner genes of both were found at the breakpoints of the chromosomal rearrangements. Thus, MYCBP::EHD2 is the product of recombination of one gene in 1p34 (MYCBP), visibly affected as a del(1)(p34), and another in the q13.33 subband (EHD2), affected by the interstitial deletion of chromosome 19, whereas the RUNX1::ZNF780A chimera is a product of the deletion of chromosome 21 and the proximal breakpoint of the 19q13.2. To the best of our knowledge, this is the first time that these fusion genes, i.e. MYCBP::EHD2 and RUNX1::ZNF780A, are described.
MYCBP codes for a protein which binds to the N-terminal transactivation domain of MYC, enhancing the latter protein’s transcriptional activation ability (36). MYCBP was also found to interact with the A kinase anchoring proteins AKAP1 and AKAP8 (37, 38) as well as ADP ribosylation factor guanine nucleotide exchange factors 1 and 2 (ARFGEF1 and ARFGEF2), which play important roles in intracellular vesicular trafficking (39). Because the promoter of MYCBP contains binding sites for the lymphoid enhancer binding factor 1 (LEF1), MYCBP expression can be regulated through the beta-catenin/LEF1 pathway (40). LEF1 (on 4q25) is highly expressed in T-cells (41, 42). In lower grade gliomas, loss of MYCBP was found to be associated with an improved survival (43). MYCBP is involved in proliferation, migration, and invasion of colorectal cancer (44) and in progression of lung adenocarcinoma (45).
The four paralogue genes EHD1 (chromosome subband 11q13.1), EHD2 (19q13.33), EHD3 (2p23.1), and EHD4 (15q15.1) code for Eps15 homology domain (EHD) proteins involved in the regulation of endocytic trafficking but in separate subcellular locations (46-49). At the N terminus, the EHD proteins contain a nucleotide-binding consensus site whereas at the C-terminus, they have an EF-hand calcium-binding EHD domain which interacts with proteins through binding to NPF motifs (46-50). According to the model proposed by Naslavsky and Caplan (49), “cytoplasmic localized EHD proteins bind ATP and dimerize. EHD dimerization causes the formation of a membrane binding site and the EHD proteins associate with tubular membranes, where they undergo further oligomerization. Upon ATP hydrolysis, the membranes are destabilized, leading to scission of vesicles containing concentrated cargo/receptors, thus facilitating vesicular transport”.
EHD2 has been found to be located in the inner leaflet of plasma membrane where it may interact with the actin cytoskeleton and bind to EHBP1 protein through its N-terminal and C-terminal EH domains (51). This interaction indicates that EHD2 may be involved in clathrin-dependent endocytosis to actin and endosome recycling (50-54). EHD2 has also been found to interact with the proteins GLUT4, AP-1 subunit μ1, AP-2 subunit μ2, CALM, Rabenosyn-5, Myoferlin and prohibitin (48-50) and to be able to enter the nucleus where it represses transcription (55).
Based on the reference sequences NM_012333.5/NP_036465.2 and NM_014601.4/NP_055416.2 for the genes MYCBP and EHD2, respectively, the MYCBP::EHD2 chimera was predicted to code for a 327 amino acid chimeric peptide consisting of the first 89 amino acids of MYCB and the last 238 of EHD2 (amino acids 307-543 in NP_055416.2). Thus, it would contain the N-terminal part of MYCBP which increases the transcription activity of MYC, and the part of EHD2 protein which contains the bipartite nuclear localization signal, the membrane binding region, nuclear export signal, and the EHD domain at the C-terminus (Figure 8). Two algorithms for prediction of eukaryotic protein subcellular localization, PSORT II and DeepLoc-2.0, predict that MYCBP::EHD2 is a cytoplasmic protein (56, 57). However, functional studies are needed to determine the role of MYCBP::EHD2 in leukemogenesis.
The coding part of the chimeric MYCBP::EHD2 transcript. MYCBP sequence is shown in grey background. The domain which binds to N-terminal part of MYC and stimulates MYC activation is written with red letters. The nuclear exit signal is shown in light blue background. The EF hand motif and EPS homology domain are written with dark blue and purple letters and are shown in dark yellow background.
Based on the reference sequences NM_001754.4/NP_001745.2 and NM_001142577.2/NP_001136049.1 for the genes RUNX1 and ZNF780A, the RUNX1::ZNF780A chimera does not result in a chimeric protein but instead, the entire coding region of ZNF780A comes under the control of the distal P1 promoter of RUNX1 (58-60). Expression of RUNX1 is driven by two alternative promoters, a proximal (P2) and a distal one (P1) (58-60). The P2 promoter is active in brain, liver, lung, kidney, heart and pancreatic tissue and drives the expression of transcript variant 2 of RUNX1 (reference sequence: NM_001001890.3) which produces the RUNX1b isoform (reference sequence NP_001001890.1, also known as AML1b) (58, 61, 62). The P1 promoter is predominantly functional in hematopoietic stem cells, megakaryocytes, as well as T lymphocytes in the thymus and spleen; it is a direct target of Wnt/β-catenin signaling and drives the expression of transcript variant 1 of RUNX1 (reference sequence NM_001754.4), which is translated to the RUNX1c isoform protein (NP_001745.2, also known as isoform AML1c) (60, 62-66). Exon 1 of transcript variant 1 of RUNX1 is a non-coding region whereas exon 2 codes for MASDSIFESFPSYPQCFMR which is out of frame with ZNF780A (58-62). The ZNF780A gene codes for a zinc finger transcription factor, located in the nucleus, which contains a krueppel associated box domain, two double zinc-finger domains, a region with multiple C2H2 zinc fingers, and multiple DNA-binding sites (https://www.ncbi.nlm.nih.gov/protein/NP_001136049.1). It was found to have prognostic and predictive value for hepatocellular carcinoma together with fourteen others transcription factors (67). Recently, recurrent ZNF780A mutations were reported in myxofibrosarcomas (68). The exact cellular function of ZNF780A and its role in the development and progression of neoplasms are currently unknown.
Conclusion
In conclusion, we used in the present study G-banding, aCGH, RNA sequencing, RT-PCR/Sanger sequencing and FISH to identify both heterozygous losses and generation of two fusion genes, MYCBP::EHD2 and RUNX1::ZNF780A, in bone marrow cells from a 17-year-old boy with T-ALL. Because the partner genes in the two chimeras were found at the breakpoints of the chromosomal deletion, we believe that both the heterozygous loss(es) and the generation of the two chimeras occurred simultaneously, and that they were pathogenetically important.
Acknowledgements
This study was supported by grants from Radiumhospitalets Legater.
Footnotes
Authors’ Contributions
IP designed and supervised the research, performed molecular genetic experiments, the bioinformatics analysis, and wrote the manuscript. KA performed molecular genetic experiments and interpreted the data. IMRJ made clinical evaluations and treated the patient. FM evaluated the data. SH assisted with experimental design and writing of the manuscript. All Authors read and approved of the final manuscript.
Conflicts of Interest
The Authors declare that they have no potential conflicts of interest.
- Received November 3, 2022.
- Revision received November 16, 2022.
- Accepted November 23, 2022.
- Copyright © 2023, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).
