Research ArticleArticle
Open Access

Novel MYCBP::EHD2 and RUNX1::ZNF780A Fusion Genes in T-cell Acute Lymphoblastic Leukemia

IOANNIS PANAGOPOULOS, KRISTIN ANDERSEN, INGA MARIA RINVOLL JOHANNSDOTTIR, FRANCESCA MICCI and SVERRE HEIM
Cancer Genomics & Proteomics January 2023, 20 (1) 51-63; DOI: https://doi.org/10.21873/cgp.20364

Abstract

Background/Aim: T-cell acute lymphoblastic leukemia (T-ALL) is a rare malignancy characterized by proliferation of early T-cell precursors that replace normal hematopoietic cells. T-ALL cells carry non-random chromosome aberrations, fusion genes, and gene mutations, often of prognostic significance. We herein report the genetic findings in cells from a T-ALL patient. Materials and Methods: Bone marrow cells from a patient with T-ALL were examined using G-banding, array comparative genomic hybridization (aCGH), RNA sequencing, reverse transcription polymerase chain reaction (RT-PCR), Sanger sequencing, and fluorescence in situ hybridization. Results: G-banding revealed del(1)(p34), add(5)(q14), trisomy 8, and monosomy 21 in the leukemic cells. aCGH detected the gross unbalances inferred from the karyotyping results, except that heterozygous loss of chromosome 21 did not include its distal part; 21q22.12-q22.3 was undeleted. In addition, aCGH detected a submicroscopic interstitial 7.56 Mbp deletion in the q arm of chromosome 19 from 19q13.2 to 19q13.33. RNA sequencing detected and RT-PCR/Sanger sequencing confirmed the presence of two novel chimeras, MYCBP::EHD2 and RUNX1::ZNF780A. They were generated from rearrangements involving subbands 1p34.3 (MYCBP), 19q13.2 (ZNF780A), 19q13.33 (EHD2), and 21q22.12 (RUNX1), i.e., at the breakpoints of chromosomal deletions. Conclusion: The leukemic cells showed the heterozygous loss of many genes as well as the generation of MYCBP::EHD2 and RUNX1::ZNF780A chimeras. Because the partner genes in the chimeras were found at the breakpoints of the chromosomal deletions, we believe that both the heterozygous losses and the generation of the two chimeras occurred simultaneously, and that they were pathogenetically important.

Key Words:

T-cell acute lymphoblastic leukemia (T-ALL) is a rare malignant disease that accounts for 10-15% of pediatric ALL and 25% of adult ALL. The leukemia is characterized by proliferation of early T-cell precursors replacing the normal hematopoietic cells (1-3). Cytogenetic examination of T-ALL cells has shown that they carry non-random numerical and/or structural chromosome aberrations (this is also typical in other leukemias) that are of diagnostic as well as prognostic importance (4, 5). Molecular investigations of some of these aberrations has led to the identification of recurrent fusion genes (5) and unraveled their role in leukemogenesis. In recent years, utilization of high throughput sequencing technology on T-ALLs has revealed also numerous other fusion genes and gene mutations (6-9). The combined use of high throughput sequencing, mainly transcriptome sequencing, and karyotyping has detected specific fusion genes of unquestionable pathogenetic significance (10-16).

In the present study, we applied the above-mentioned methodological combination on a T-ALL searching for fusion genes.

Materials and Methods

Ethics statement. The study was approved by the regional ethics committee (Regional komité for medisinsk forskningsetikk Sør-Øst, Norge, http://helseforskning.etikkom.no, REK: 19178). Written informed consent was obtained from the patient prior to publication of case details. The ethics committee’s approval included a review of the consent procedure. All patient information has been de-identified.

Case report. The patient was a previously healthy 17-year-old boy, admitted to the hospital due to symptoms of upper respiratory tract infection, dysphagia, and an enlarged supraclavicular lymph node. CT-scan of the thorax revealed a tumour in the anterior mediastinum, measuring nine centimetres in the largest diameter. Biopsies from bone marrow and lymph node confirmed an early precursor T-cell leukaemia. He started treatment according to the ALLTogether protocol (17) [ALLTogether1 – A Treatment study protocol of the ALLTogether Consortium for children and young adults (0-45 years of age) with newly diagnosed acute lymphoblastic leukaemia (ALL)], with a slow response and was stratified to the high-risk group. During his treatment he developed pancreatitis and polyneuropathy. He went through a bone marrow transplantation seven months post-diagnosis and is still in remission 1.5 years later.

G-banding and karyotyping. Bone marrow cells obtained at diagnosis were cytogenetically investigated (18, 19). Chromosome preparations were made from metaphase cells of a 24 h culture; they were G-banded using Leishman stain, and karyotyped according to the guidelines of the international system for human cytogenomic nomenclature (2020) (20).

DNA and RNA isolation and complementary DNA (cDNA) synthesis. Genomic DNA and total RNA were extracted from the patient’s bone marrow samples at diagnosis. DNA was extracted using the Maxwell 16 Instrument System and the Maxwell 16 Cell DNA Purification Kit (Promega, Madison, WI, USA) and the concentration was measured with a Quantus fluorometer (Promega). Total RNA was extracted using the miRNeasy Mini Kit (Qiagen, Hilden, Germany) and the QiaCube automated purification system according to the manufacturer’s instructions (Qiagen); the concentration was measured with the QIAxpert microfluidic UV/VIS spectrophotometer (Qiagen). The Agilent 2100 bioanalyzer and RNA Integrity Number (RIN) were used to assess RNA quality (21). RIN of RNA was 6.6. cDNA was synthesized from one μg of total RNA using the iScript Advanced cDNA Synthesis Kit for RT-qPCR according to the manufacturer’s instructions (Bio-Rad, Hercules, CA, USA). The quality of the cDNA synthesis was assessed by amplification of a cDNA fragment of the ABL protooncogene 1, non-receptor tyrosine kinase (ABL1) gene using the primer combination ABL1-91F1/ABL1-404R1 (Table I) (22, 23).

View this table:
Table I.

Designation, sequence (5′->3′), and position in reference sequences of the forward (F) and reverse (R) primers of the genes MYC binding protein (MYCBP), EH domain containing 2 (EHD2), RUNX family transcription factor 1 (RUNX1) and zinc finger protein 780A (ZNF780A), which were used for polymerase chain reaction amplification and Sanger sequencing analyses. For Sanger sequencing analyses the forward primers had the M13 forward primer sequence TGTAAAACGACGGCCAGT at their 5′-end. The reverse primers had the M13 reverse primer sequence CAGGAAACAGCTATGACC at their 5′-end.

Array comparative genomic hybridization (aCGH) analysis. aCGH was performed using the CytoSure array products (Oxford Gene Technology, Begbroke, Oxfordshire, UK) following the company’s protocols (14). The reference DNA was Promega’s human genomic male DNA (Promega). The slides (CytoSure Cancer +SNP array) were scanned in an Agilent SureScan Dx microarray scanner using Agilent Feature Extraction Software (version 12.1.1.1). Data were analyzed using the CytoSure Interpret analysis software (version 4.9.40). Annotations are based on human genome build 19.

RNA sequencing. High-throughput paired-end RNA-sequencing was performed at the Genomics Core Facility, Norwegian Radium Hospital, Oslo University Hospital (http://genomics.no/oslo/). The software FusionCatcher was used to find fusion transcripts (24).

PCR and Sanger sequencing analyses. The primers used for PCR amplification and Sanger sequencing are listed in Table I. The methods involved in PCR amplification and cycle Sanger sequencing have been described in detail in our previous studies (13, 14, 22, 23, 25, 26). Sequence analyses were performed on the Applied Biosystems SeqStudio Genetic Analyzer system (ThermoFisher Scientific). The basic local alignment search tool (BLAST) software (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used for computer analysis of sequence data (27). The BLAT alignment tool and the human genome browser at UCSC were also used to map the sequences on the Human GRCh37/hg19 assembly (28, 29).

Fluorescence in situ hybridization (FISH) analysis. FISH analysis was performed on metaphase plates using in-house prepared probes made from commercially available bacterial artificial chromosomes (BAC), purchased from the BACPAC Resource Center operated by BACPAC Genomics, Emeryville, CA, USA (https://bacpacresources.org/) (Table II). BAC DNAs and labeling of the probes were prepared as previously described (30-32). Probes were labelled with Texas Red-5-dCTP (PerkinElmer, Boston, MA, USA) to obtain a red signal and fluorescein-12-dCTP (PerkinElmer) to obtain a green signal. Chromosome preparations were counterstained with 0.2 μg/ml 4′,6-diamidino-2-phenylindole and overlaid with a 24×50 mm2 coverslip. Fluorescent signals were captured and analyzed using the CytoVision system (Leica Biosystems, Newcastle, UK). Mapping of the clones on normal controls was performed to confirm their chromosomal location (Table II).

View this table:
Table II.

BAC probes used for fluorescence in situ hybridization (FISH) experiments in order to detect the MYCBP::EHD2 chimera. The position of the MYCB and EHD2 genes is also given.

Results

Cytogenetics and aCGH analyses. Cytogenetic examination of short-term cultured cells from the patient´s bone marrow revealed a deletion on the p arm of chromosome 1, an addition of extra material of unknown chromosomal origin on the long arm of chromosome 5, a gain of chromosome 8, and loss of one chromosome 21 on 6 out of 10 examined metaphases (Figure 1). Consequently, the karyotype was: 46,XY,del(1)(p34),add(5)(q14),+8,-21[6]/46,XY[4].

Figure 1.
Figure 1.

G-banding analysis of the bone marrow cells of the T-ALL patient. A karyogram is shown, depicting the chromosome aberrations of the leukemic cells corresponding to the karyotype 46,XY,del(1)(p34),add(5)(q14),+8,-21. Arrows indicate breakpoints.

The results from aCGH are shown in Figure 2, Figure 3, Figure 4, Figure 5 and Figure 6. aCGH confirmed the del(1)(p34), revealing that the breakpoint was in the subband 1p34.3, in the area hosting the genes Ras related GTP binding C (RRAGC), MYC binding protein (MYCBP), gap junction protein alpha 9 (GJA9) and rhomboid like 2 (RHBDL2) (Figure 2, Figure 3A and B). Because there were no probes on MYCBP and GJA9, the breakpoint could not map more precisely (Figure 3B). For chromosome 5, the aCGH analysis showed that the cytogenetically detected add(5)(q14) was accompanied by a deletion which started at 5q14, just downstream of the adhesion G protein-coupled receptor V1 gene (ADGRV1, also known as GRP98) (Figure 2, Figure 4A and B). Besides confirming the cytogenetically observed trisomy for chromosome 8 (Figure 2), aCGH also detected an interstitial deletion in 19q13 (Figure 2 and Figure 5) that started between the zinc finger protein 780A (ZNF780A) and mitogen-activated protein kinase 10 (MAP3K10) genes (Figure 5A and B) and ended in EH domain containing 2 (EHD2) (Figure 5A and C). Because of the low number of probes at the breakpoint regions, the interstitial deletion in 19q13 could not be mapped more precisely (Figure 5B and C). aCGH also showed loss of a large part of chromosome 21 (21p11.2-q22.2) (Figure 2, Figure 6A and B). However, 21q22.12-q22.3, including exons 1 and 2 of RUNX1, was not deleted (Figure 6B).

Figure 2.
Figure 2.

Array comparative genomic hybridization (aCGH) examination of the bone marrow cells of the T-ALL patient. (A) Genetic profile of whole genome showing trisomy for chromosome 8 and losses from parts of chromosomes 1, 5, 19, and 21. (B) The cytogenetic location, position on GRCh37/hg19 assembly, size (in Mbp), and gain/loss of the genetic imbalances are presented.

Figure 3.
Figure 3.

aCGH showing the deleted part of the p arm of chromosome 1. (A) Based on the hg19 assembly the deletion ended at position chr1:39311945, on the subband 1p34.3. The most distal (p-telomeric) probe in the assay mapped at position chr1:10478. (B) The area at position chr1:39311945 hosting the genes Ras related GTP binding C (RRAGC), MYC binding protein (MYCBP), gap junction protein alpha 9 (GJA9) and rhomboid like 2 (RHBDL2). Because there were no probes on MYCBP and GJA9, the breakpoint could not map more precisely. Highlights indicate the deleted (loss) part.

Figure 4.
Figure 4.

aCGH showing the deleted part of the q arm of chromosome 5. (A) The deletion started at position chr5:90488653 on the subband 5q14.3 and ended on subband 5q35.3. The most distal (q-telomeric) probe in the assay mapped at position chr5: 180787863. (B) The area at position chr5:90488653 shows that the deletion is just downstream of the adhesion G protein-coupled receptor V1 gene (ADGRV1, also known as GRP98). Highlights indicate the deleted (loss) part.

Figure 5.
Figure 5.

aCGH analysis showing the interstitial deletion in q arm of chromosome 19. (A) Genetic profile of whole chromosome 19 showing the deletion started at position Chr19:40662574 on subband 19q13.2 and ended at chr19: 48223904 on subband 19q13.33. (B) The area at position Chr19:40662574 showing that the deletion started between the genes zinc finger protein 780A (ZNF780A) and mitogen-activated protein kinase 10 (MAP3K10). (C) The area at position chr19: 48223904 showing that deletion ended within the EH domain containing 2 (EHD2) gene. Because of the low number of probes at the breakpoint regions, the interstitial deletion in 19q13 could not be mapped more precisely. Highlights indicate the deleted (loss) part.

Figure 6.
Figure 6.

aCGH analysis showing the deleted part of chromosome 21. (A) The deletion ended at position Chr21: 36299935 on the subband 21q22.13. The most distal probe on the p arm of chromosome 21 in the assay mapped at position Chr21:10773805. (B) The area at position Chr21: 36299935 showing that the deletion ended within intron 2 of RUNX1.

RNA sequencing, RT-PCR, and Sanger sequencing analyses. Analysis of raw sequencing data using FusionCatcher detected two fusion transcripts. The first transcript was a fusion of exon 4 of MYCBP from 1p34.4 (nucleotide 310 in reference sequence NM_012333.5) with exon 5 of EHD2 from 19q13.33 (nucleotide 1088 in reference sequence NM_014601.4): AAGAGAAGTATGAAGCTATTGTAGAAGAAAATAAAAA ACTGAAAGCAAAG::GTTCACGCTTACATCATCAGCTA CCTGAAGAAGGAGATGCCCTCTGTGTT. The second chimeric transcript was a fusion of exon 2 of RUNX1 from 21q22.12 (nucleotide 248 in reference sequence NM_001754.4) with exon 3 of ZNF780A from 19q13.2 (nucleotide 109 in reference sequence NM_001142577.2): AGACAGCATATTTGAGTCATTTCCTTCGTACCCACAGT GCTTCATGAGAG::GGGAGAAGCCCGAGGAAGATTGA CCAGTTTTGTAATTCTAGCAACATGGT.

RT-PCR using the MYCBP-199F1 and EHD2-1197R1 primer combination amplified a 245 bp cDNA fragment which was shown by Sanger sequencing to confirm the MYCBP::EHD2 fusion transcript detected by the RNA sequencing/FusionCatcher analysis (Figure 7A). RT-PCR with RUNX1-155F1 and ZNF780A-199R1 primers amplified a 206 bp fragment, which confirmed (by Sanger sequencing) the RUNX1::ZNF780A fusion transcript detected by the RNA sequencing/FusionCatcher (Figure 7B).

Figure 7.
Figure 7.

Sanger sequencing and fluorescence in situ hybridization (FISH) of the bone marrow cells of the T-ALL patient. (A) Partial Sanger sequencing chromatogram showing the junction between exon 4 of MYCBP and exon 2 of EHD2. (B) Partial Sanger sequencing chromatogram showing the junction between exon 2 of RUNX1 and exon 3 of ZNF780A. (C) FISH analysis on metaphase plates using in-house prepared probes for the MYCBP (red labeled) and EHD2 (green label) genes showed a red signal corresponding to normal MYCBP on chromosome 1, a green signal on normal chromosome 19 corresponding to EHD2, a fusion red/green signal on der(1) chromosome which corresponded to the MYCBP::EHD2 chimera, and a red signal on der(19) indicating that material from chromosome bad 1p34 translocated to q13 of der(19).

Fluorescence in situ hybridization (FISH) analyses. FISH analysis on metaphase plates using in-house prepared probes for the MYCBP (red labeled) and EHD2 (green label) genes showed a red signal corresponding to a normal MYCBP on chromosome 1, a green signal on normal chromosome 19 corresponding to EHD2, a fusion red/green signal on der(1) chromosome corresponding to a MYCBP::EHD2 chimera, and a red signal on der(19) indicating that material from chromosome band 1p34 had been moved to band q13 of the der(19) (Figure 7C).

Discussion

As a consequence of the chromosomal aberrations, there was heterozygous loss of many genes on chromosomes 1, 5, 19 and 21, due to the del(1)(p34), add(5)(q14), interstitial deletion on 19q, and deletion of a large part of chromosome 21, found by aCGH and/or G-banding. Trisomy 8 was also part of the karyotype; this aberration is common in leukemia(s) both as the sole abnormality and as a secondary change, although its exact role in leukemogenesis remains enigmatic (33-35). In the Mitelman database of chromosome aberrations and gene fusions in cancer (last updated on July 27, 2022), only 245 out of 3225 (7.6%) T-cell lineage acute lymphoblastic leukemia/lymphoblastic lymphoma entries have been reported with +8 in their karyotype. In most of them, the +8 was a secondary aberration (33).

In addition to genomic imbalances, the cytogenetic aberrations also resulted in generation of the MYCBP::EHD2 and RUNX1::ZNF780A chimeras, since the partner genes of both were found at the breakpoints of the chromosomal rearrangements. Thus, MYCBP::EHD2 is the product of recombination of one gene in 1p34 (MYCBP), visibly affected as a del(1)(p34), and another in the q13.33 subband (EHD2), affected by the interstitial deletion of chromosome 19, whereas the RUNX1::ZNF780A chimera is a product of the deletion of chromosome 21 and the proximal breakpoint of the 19q13.2. To the best of our knowledge, this is the first time that these fusion genes, i.e. MYCBP::EHD2 and RUNX1::ZNF780A, are described.

MYCBP codes for a protein which binds to the N-terminal transactivation domain of MYC, enhancing the latter protein’s transcriptional activation ability (36). MYCBP was also found to interact with the A kinase anchoring proteins AKAP1 and AKAP8 (37, 38) as well as ADP ribosylation factor guanine nucleotide exchange factors 1 and 2 (ARFGEF1 and ARFGEF2), which play important roles in intracellular vesicular trafficking (39). Because the promoter of MYCBP contains binding sites for the lymphoid enhancer binding factor 1 (LEF1), MYCBP expression can be regulated through the beta-catenin/LEF1 pathway (40). LEF1 (on 4q25) is highly expressed in T-cells (41, 42). In lower grade gliomas, loss of MYCBP was found to be associated with an improved survival (43). MYCBP is involved in proliferation, migration, and invasion of colorectal cancer (44) and in progression of lung adenocarcinoma (45).

The four paralogue genes EHD1 (chromosome subband 11q13.1), EHD2 (19q13.33), EHD3 (2p23.1), and EHD4 (15q15.1) code for Eps15 homology domain (EHD) proteins involved in the regulation of endocytic trafficking but in separate subcellular locations (46-49). At the N terminus, the EHD proteins contain a nucleotide-binding consensus site whereas at the C-terminus, they have an EF-hand calcium-binding EHD domain which interacts with proteins through binding to NPF motifs (46-50). According to the model proposed by Naslavsky and Caplan (49), “cytoplasmic localized EHD proteins bind ATP and dimerize. EHD dimerization causes the formation of a membrane binding site and the EHD proteins associate with tubular membranes, where they undergo further oligomerization. Upon ATP hydrolysis, the membranes are destabilized, leading to scission of vesicles containing concentrated cargo/receptors, thus facilitating vesicular transport”.

EHD2 has been found to be located in the inner leaflet of plasma membrane where it may interact with the actin cytoskeleton and bind to EHBP1 protein through its N-terminal and C-terminal EH domains (51). This interaction indicates that EHD2 may be involved in clathrin-dependent endocytosis to actin and endosome recycling (50-54). EHD2 has also been found to interact with the proteins GLUT4, AP-1 subunit μ1, AP-2 subunit μ2, CALM, Rabenosyn-5, Myoferlin and prohibitin (48-50) and to be able to enter the nucleus where it represses transcription (55).

Based on the reference sequences NM_012333.5/NP_036465.2 and NM_014601.4/NP_055416.2 for the genes MYCBP and EHD2, respectively, the MYCBP::EHD2 chimera was predicted to code for a 327 amino acid chimeric peptide consisting of the first 89 amino acids of MYCB and the last 238 of EHD2 (amino acids 307-543 in NP_055416.2). Thus, it would contain the N-terminal part of MYCBP which increases the transcription activity of MYC, and the part of EHD2 protein which contains the bipartite nuclear localization signal, the membrane binding region, nuclear export signal, and the EHD domain at the C-terminus (Figure 8). Two algorithms for prediction of eukaryotic protein subcellular localization, PSORT II and DeepLoc-2.0, predict that MYCBP::EHD2 is a cytoplasmic protein (56, 57). However, functional studies are needed to determine the role of MYCBP::EHD2 in leukemogenesis.

Figure 8.
Figure 8.

The coding part of the chimeric MYCBP::EHD2 transcript. MYCBP sequence is shown in grey background. The domain which binds to N-terminal part of MYC and stimulates MYC activation is written with red letters. The nuclear exit signal is shown in light blue background. The EF hand motif and EPS homology domain are written with dark blue and purple letters and are shown in dark yellow background.

Based on the reference sequences NM_001754.4/NP_001745.2 and NM_001142577.2/NP_001136049.1 for the genes RUNX1 and ZNF780A, the RUNX1::ZNF780A chimera does not result in a chimeric protein but instead, the entire coding region of ZNF780A comes under the control of the distal P1 promoter of RUNX1 (58-60). Expression of RUNX1 is driven by two alternative promoters, a proximal (P2) and a distal one (P1) (58-60). The P2 promoter is active in brain, liver, lung, kidney, heart and pancreatic tissue and drives the expression of transcript variant 2 of RUNX1 (reference sequence: NM_001001890.3) which produces the RUNX1b isoform (reference sequence NP_001001890.1, also known as AML1b) (58, 61, 62). The P1 promoter is predominantly functional in hematopoietic stem cells, megakaryocytes, as well as T lymphocytes in the thymus and spleen; it is a direct target of Wnt/β-catenin signaling and drives the expression of transcript variant 1 of RUNX1 (reference sequence NM_001754.4), which is translated to the RUNX1c isoform protein (NP_001745.2, also known as isoform AML1c) (60, 62-66). Exon 1 of transcript variant 1 of RUNX1 is a non-coding region whereas exon 2 codes for MASDSIFESFPSYPQCFMR which is out of frame with ZNF780A (58-62). The ZNF780A gene codes for a zinc finger transcription factor, located in the nucleus, which contains a krueppel associated box domain, two double zinc-finger domains, a region with multiple C2H2 zinc fingers, and multiple DNA-binding sites (https://www.ncbi.nlm.nih.gov/protein/NP_001136049.1). It was found to have prognostic and predictive value for hepatocellular carcinoma together with fourteen others transcription factors (67). Recently, recurrent ZNF780A mutations were reported in myxofibrosarcomas (68). The exact cellular function of ZNF780A and its role in the development and progression of neoplasms are currently unknown.

Conclusion

In conclusion, we used in the present study G-banding, aCGH, RNA sequencing, RT-PCR/Sanger sequencing and FISH to identify both heterozygous losses and generation of two fusion genes, MYCBP::EHD2 and RUNX1::ZNF780A, in bone marrow cells from a 17-year-old boy with T-ALL. Because the partner genes in the two chimeras were found at the breakpoints of the chromosomal deletion, we believe that both the heterozygous loss(es) and the generation of the two chimeras occurred simultaneously, and that they were pathogenetically important.

Acknowledgements

This study was supported by grants from Radiumhospitalets Legater.

Footnotes

  • Authors’ Contributions

    IP designed and supervised the research, performed molecular genetic experiments, the bioinformatics analysis, and wrote the manuscript. KA performed molecular genetic experiments and interpreted the data. IMRJ made clinical evaluations and treated the patient. FM evaluated the data. SH assisted with experimental design and writing of the manuscript. All Authors read and approved of the final manuscript.

  • Conflicts of Interest

    The Authors declare that they have no potential conflicts of interest.

  • Received November 3, 2022.
  • Revision received November 16, 2022.
  • Accepted November 23, 2022.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).

References

  1. ↵
    1. Raetz EA and
    2. Teachey DT
    : T-cell acute lymphoblastic leukemia. Hematology Am Soc Hematol Educ Program 2016(1): 580-588, 2016. PMID: 27913532. DOI: 10.1182/asheducation-2016.1.580
    OpenUrlAbstract/FREE Full Text
    1. Girardi T,
    2. Vicente C,
    3. Cools J and
    4. De Keersmaecker K
    : The genetics and molecular biology of T-ALL. Blood 129(9): 1113-1123, 2017. PMID: 28115373. DOI: 10.1182/blood-2016-10-706465
    OpenUrlAbstract/FREE Full Text
  3. ↵
    1. Terwilliger T and
    2. Abdul-Hay M
    : Acute lymphoblastic leukemia: a comprehensive review and 2017 update. Blood Cancer J 7(6): e577, 2017. PMID: 28665419. DOI: 10.1038/bcj.2017.53
    OpenUrlCrossRefPubMed
  4. ↵
    1. Graux C,
    2. Cools J,
    3. Michaux L,
    4. Vandenberghe P and
    5. Hagemeijer A
    : Cytogenetics and molecular genetics of T-cell acute lymphoblastic leukemia: from thymocyte to lymphoblast. Leukemia 20(9): 1496-1510, 2006. PMID: 16826225. DOI: 10.1038/sj.leu.2404302
    OpenUrlCrossRefPubMed
  5. ↵
    1. Heim S and
    2. Mitelman F
    : Cancer cytogenetics: Chromosomal and molecular genetic abberations of tumor cells. Fourth Edition edn. Wiley-Blackwell, 2015.
  6. ↵
    1. Mullighan CG
    : The genomic landscape of acute lymphoblastic leukemia in children and young adults. Hematology Am Soc Hematol Educ Program 2014(1): 174-180, 2014. PMID: 25696852. DOI: 10.1182/asheducation-2014.1.174
    OpenUrlAbstract/FREE Full Text
    1. Liu Y,
    2. Easton J,
    3. Shao Y,
    4. Maciaszek J,
    5. Wang Z,
    6. Wilkinson MR,
    7. McCastlain K,
    8. Edmonson M,
    9. Pounds SB,
    10. Shi L,
    11. Zhou X,
    12. Ma X,
    13. Sioson E,
    14. Li Y,
    15. Rusch M,
    16. Gupta P,
    17. Pei D,
    18. Cheng C,
    19. Smith MA,
    20. Auvil JG,
    21. Gerhard DS,
    22. Relling MV,
    23. Winick NJ,
    24. Carroll AJ,
    25. Heerema NA,
    26. Raetz E,
    27. Devidas M,
    28. Willman CL,
    29. Harvey RC,
    30. Carroll WL,
    31. Dunsmore KP,
    32. Winter SS,
    33. Wood BL,
    34. Sorrentino BP,
    35. Downing JR,
    36. Loh ML,
    37. Hunger SP,
    38. Zhang J and
    39. Mullighan CG
    : The genomic landscape of pediatric and young adult T-lineage acute lymphoblastic leukemia. Nat Genet 49(8): 1211-1218, 2017. PMID: 28671688. DOI: 10.1038/ng.3909
    OpenUrlCrossRefPubMed
    1. Chen B,
    2. Jiang L,
    3. Zhong ML,
    4. Li JF,
    5. Li BS,
    6. Peng LJ,
    7. Dai YT,
    8. Cui BW,
    9. Yan TQ,
    10. Zhang WN,
    11. Weng XQ,
    12. Xie YY,
    13. Lu J,
    14. Ren RB,
    15. Chen SN,
    16. Hu JD,
    17. Wu DP,
    18. Chen Z,
    19. Tang JY,
    20. Huang JY,
    21. Mi JQ and
    22. Chen SJ
    : Identification of fusion genes and characterization of transcriptome features in T-cell acute lymphoblastic leukemia. Proc Natl Acad Sci USA 115(2): 373-378, 2018. PMID: 29279377. DOI: 10.1073/pnas.1717125115
    OpenUrlAbstract/FREE Full Text
  9. ↵
    1. Mansur MB,
    2. Furness CL,
    3. Nakjang S,
    4. Enshaei A,
    5. Alpar D,
    6. Colman SM,
    7. Minto L,
    8. Irving J,
    9. Poole BV,
    10. Noronha EP,
    11. Savola S,
    12. Iqbal S,
    13. Gribben J,
    14. Pombo-de-Oliveira MS,
    15. Ford TM,
    16. Greaves MF and
    17. van Delft FW
    : The genomic landscape of teenage and young adult T-cell acute lymphoblastic leukemia. Cancer Med 10(14): 4864-4873, 2021. PMID: 34080325. DOI: 10.1002/cam4.4024
    OpenUrlCrossRefPubMed
  10. ↵
    1. Lu QR,
    2. Yuk D,
    3. Alberta JA,
    4. Zhu Z,
    5. Pawlitzky I,
    6. Chan J,
    7. McMahon AP,
    8. Stiles CD and
    9. Rowitch DH
    : Sonic hedgehog—regulated oligodendrocyte lineage genes encoding bHLH proteins in the mammalian central nervous system. Neuron 25(2): 317-329, 2000. PMID: 10719888. DOI: 10.1016/s0896-6273(00)80897-1
    OpenUrlCrossRefPubMed
    1. Tanas MR,
    2. Sboner A,
    3. Oliveira AM,
    4. Erickson-Johnson MR,
    5. Hespelt J,
    6. Hanwright PJ,
    7. Flanagan J,
    8. Luo Y,
    9. Fenwick K,
    10. Natrajan R,
    11. Mitsopoulos C,
    12. Zvelebil M,
    13. Hoch BL,
    14. Weiss SW,
    15. Debiec-Rychter M,
    16. Sciot R,
    17. West RB,
    18. Lazar AJ,
    19. Ashworth A,
    20. Reis-Filho JS,
    21. Lord CJ,
    22. Gerstein MB,
    23. Rubin MA and
    24. Rubin BP
    : Identification of a disease-defining gene fusion in epithelioid hemangioendothelioma. Sci Transl Med 3(98): 98ra82, 2011. PMID: 21885404. DOI: 10.1126/scitranslmed.3002409
    OpenUrlAbstract/FREE Full Text
    1. Panagopoulos I,
    2. Thorsen J,
    3. Gorunova L,
    4. Micci F and
    5. Heim S
    : Sequential combination of karyotyping and RNA-sequencing in the search for cancer-specific fusion genes. Int J Biochem Cell Biol 53: 462-465, 2014. PMID: 24863361. DOI: 10.1016/j.biocel.2014.05.018
    OpenUrlCrossRefPubMed
  13. ↵
    1. Panagopoulos I,
    2. Andersen K,
    3. Eilert-Olsen M,
    4. Rognlien AG,
    5. Munthe-Kaas MC,
    6. Micci F and
    7. Heim S
    : Rare KMT2A-ELL and novel ZNF56-KMT2A fusion genes in pediatric T-cell acute lymphoblastic leukemia. Cancer Genomics Proteomics 18(2): 121-131, 2021. PMID: 33608309. DOI: 10.21873/cgp.20247
    OpenUrlAbstract/FREE Full Text
  14. ↵
    1. Panagopoulos I,
    2. Andersen K,
    3. Eilert-Olsen M,
    4. Zeller B,
    5. Munthe-Kaas MC,
    6. Buechner J,
    7. Osnes LTN,
    8. Micci F and
    9. Heim S
    : Therapy-induced deletion in 11q23 leading to fusion of KMT2A with ARHGEF12 and development of B lineage acute lymphoplastic leukemia in a child treated for acute myeloid leukemia caused by t(9;11)(p21;q23)/KMT2A-MLLT3. Cancer Genomics Proteomics 18(1): 67-81, 2021. PMID: 33419897. DOI: 10.21873/cgp.20242
    OpenUrlAbstract/FREE Full Text
    1. Panagopoulos I and
    2. Heim S
    : Interstitial deletions generating fusion genes. Cancer Genomics Proteomics 18(3): 167-196, 2021. PMID: 33893073. DOI: 10.21873/cgp.20251
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Panagopoulos I and
    2. Heim S
    : Neoplasia-associated chromosome translocations resulting in gene truncation. Cancer Genomics Proteomics 19(6): 647-672, 2022. PMID: 36316036. DOI: 10.21873/cgp.20349
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. EU Clinical Trials Register
    : ALLTogether1–A treatment study protocol of the ALLTogether Consortium for children and young adults (0-45 years of age) with newly diagnosed acute lymphoblastic leukaemia (ALL). EUDRACT number: 2018-001795-38.
  18. ↵
    1. Rooney DE
    1. Czepulkowski B
    : Basic techniques for the preparation and analysis of chromosomes from bone marrow and leukaemic blood. In: Human cytogenetics: malignancy and acquired abnormalities. Rooney DE (ed.). Oxford University Press, New York, pp. 1-26, 2001.
  19. ↵
    1. Rooney DE
    1. Czepulkowski B and
    2. Gibbons B
    : Cytogenetics in acute lymphoblastic leukaemia. In: Human cytogenetics: malignancy and acquired abnormalities. Rooney DE (ed.). Oxford University Press, New York, pp. 57-86, 2001.
  20. ↵
    1. McGowan-Jordan J,
    2. Hastings RJ and
    3. Moore S
    : ISCN 2020: An International system for human cytogenomic nomenclature. Basel, Karger, pp. 164, 2020.
  21. ↵
    1. Schroeder A,
    2. Mueller O,
    3. Stocker S,
    4. Salowsky R,
    5. Leiber M,
    6. Gassmann M,
    7. Lightfoot S,
    8. Menzel W,
    9. Granzow M and
    10. Ragg T
    : The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Mol Biol 7: 3, 2006. PMID: 16448564. DOI: 10.1186/1471-2199-7-3
    OpenUrlCrossRefPubMed
  22. ↵
    1. Torkildsen S,
    2. Brunetti M,
    3. Gorunova L,
    4. Spetalen S,
    5. Beiske K,
    6. Heim S and
    7. Panagopoulos I
    : Rearrangement of the chromatin organizer special AT-rich binding protein 1 gene, SATB1, resulting from a t(3;5)(p24;q14) chromosomal translocation in acute myeloid leukemia. Anticancer Res 37(2): 693-698, 2017. PMID: 28179318. DOI: 10.21873/anticanres.11365
    OpenUrlAbstract/FREE Full Text
  23. ↵
    1. Panagopoulos I,
    2. Andersen K,
    3. Ramslien LF,
    4. Ikonomou IM,
    5. Micci F and
    6. Heim S
    : Therapy-related myeloid leukemia with the translocation t(8;19)(p11;q13) leading to a KAT6A-LEUTX fusion gene. Anticancer Res 41(4): 1753-1760, 2021. PMID: 33813379. DOI: 10.21873/anticanres.14940
    OpenUrlAbstract/FREE Full Text
  24. ↵
    1. Nicorici D,
    2. Satalan H,
    3. Edgren H,
    4. Kangaspeska S,
    5. Murumagi A,
    6. Kallioniemi O,
    7. Virtanen S and
    8. Kikku O
    : FusionCatcher - a tool for finding somatic fusion genes in paired-end RNA-sequencing data. bioRxiv, 2014. DOI: 10.1101/011650
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Lund-Iversen M,
    4. Bassarova A and
    5. Heim S
    : Fusion of the genes PHF1 and TFE3 in malignant chondroid syringoma. Cancer Genomics Proteomics 16(5): 345-351, 2019. PMID: 31467228. DOI: 10.21873/cgp.20139
    OpenUrlAbstract/FREE Full Text
  26. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Andersen K,
    4. Lund-Iversen M,
    5. Lobmaier I,
    6. Micci F and
    7. Heim S
    : NDRG1-PLAG1 and TRPS1-PLAG1 fusion genes in chondroid syringoma. Cancer Genomics Proteomics 17(3): 237-248, 2020. PMID: 32345665. DOI: 10.21873/cgp.20184
    OpenUrlAbstract/FREE Full Text
  27. ↵
    1. Altschul SF,
    2. Gish W,
    3. Miller W,
    4. Myers EW and
    5. Lipman DJ
    : Basic local alignment search tool. J Mol Biol 215(3): 403-410, 1990. PMID: 2231712. DOI: 10.1016/S0022-2836(05)80360-2
    OpenUrlCrossRefPubMed
  28. ↵
    1. Kent WJ
    : BLAT—the BLAST-like alignment tool. Genome Res 12(4): 656-664, 2002. PMID: 11932250. DOI: 10.1101/gr.229202
    OpenUrlAbstract/FREE Full Text
  29. ↵
    1. Kent WJ,
    2. Sugnet CW,
    3. Furey TS,
    4. Roskin KM,
    5. Pringle TH,
    6. Zahler AM and
    7. Haussler D
    : The human genome browser at UCSC. Genome Res 12(6): 996-1006, 2002. PMID: 12045153. DOI: 10.1101/gr.229102
    OpenUrlAbstract/FREE Full Text
  30. ↵
    1. Roohi J,
    2. Cammer M,
    3. Montagna C and
    4. Hatchwell E
    : An improved method for generating BAC DNA suitable for FISH. Cytogenet Genome Res 121(1): 7-9, 2008. PMID: 18544919. DOI: 10.1159/000124374
    OpenUrlCrossRefPubMed
    1. Panagopoulos I,
    2. Gorunova L,
    3. Andersen K,
    4. Lund-Iversen M,
    5. Hognestad HR,
    6. Lobmaier I,
    7. Micci F and
    8. Heim S
    : Chromosomal translocation t(5;12)(p13;q14) leading to fusion of high-mobility group AT-hook 2 gene with intergenic sequences from chromosome sub-band 5p13.2 in benign myoid neoplasms of the breast: a second case. Cancer Genomics Proteomics 19(4): 445-455, 2022. PMID: 35732319. DOI: 10.21873/cgp.20331
    OpenUrlAbstract/FREE Full Text
  32. ↵
    1. Panagopoulos I,
    2. Andersen K,
    3. Gorunova L,
    4. Davidson B,
    5. Micci F and
    6. Heim S
    : A novel cryptic t(2;3)(p21;q25) translocation fuses the WWTR1 and PRKCE genes in uterine leiomyoma with 3q- as the sole visible chromosome abnormality. Cancer Genomics Proteomics 19(5): 636-646, 2022. PMID: 35985686. DOI: 10.21873/cgp.20348
    OpenUrlAbstract/FREE Full Text
  33. ↵
    1. Mitelman F,
    2. Johansson B and
    3. Mertens F
    : Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer. Available at: https://mitelmandatabase.isb-cgc.org/ [Last accessed on November 22, 2022]
    1. Paulsson K and
    2. Johansson B
    : Trisomy 8 as the sole chromosomal aberration in acute myeloid leukemia and myelodysplastic syndromes. Pathol Biol (Paris) 55(1): 37-48, 2007. PMID: 16697122. DOI: 10.1016/j.patbio.2006.04.007
    OpenUrlCrossRefPubMed
  35. ↵
    1. Hemsing AL,
    2. Hovland R,
    3. Tsykunova G and
    4. Reikvam H
    : Trisomy 8 in acute myeloid leukemia. Expert Rev Hematol 12(11): 947-958, 2019. PMID: 31422708. DOI: 10.1080/17474086.2019.1657400
    OpenUrlCrossRefPubMed
  36. ↵
    1. Taira T,
    2. Maëda J,
    3. Onishi T,
    4. Kitaura H,
    5. Yoshida S,
    6. Kato H,
    7. Ikeda M,
    8. Tamai K,
    9. Iguchi-Ariga SM and
    10. Ariga H
    : AMY-1, a novel C-MYC binding protein that stimulates transcription activity of C-MYC. Genes Cells 3(8): 549-565, 1998. PMID: 9797456. DOI: 10.1046/j.1365-2443.1998.00206.x
    OpenUrlCrossRefPubMed
  37. ↵
    1. Furusawa M,
    2. Ohnishi T,
    3. Taira T,
    4. Iguchi-Ariga SM and
    5. Ariga H
    : AMY-1, a c-Myc-binding protein, is localized in the mitochondria of sperm by association with S-AKAP84, an anchor protein of cAMP-dependent protein kinase. J Biol Chem 276(39): 36647-36651, 2001. PMID: 11483602. DOI: 10.1074/jbc.M103885200
    OpenUrlAbstract/FREE Full Text
  38. ↵
    1. Furusawa M,
    2. Taira T,
    3. Iguchi-Ariga SM and
    4. Ariga H
    : AMY-1 interacts with S-AKAP84 and AKAP95 in the cytoplasm and the nucleus, respectively, and inhibits cAMP-dependent protein kinase activity by preventing binding of its catalytic subunit to A-kinase-anchoring protein (AKAP) complex. J Biol Chem 277(52): 50885-50892, 2002. PMID: 12414807. DOI: 10.1074/jbc.M206387200
    OpenUrlAbstract/FREE Full Text
  39. ↵
    1. Ishizaki R,
    2. Shin HW,
    3. Iguchi-Ariga SM,
    4. Ariga H and
    5. Nakayama K
    : AMY-1 (associate of Myc-1) localization to the trans-Golgi network through interacting with BIG2, a guanine-nucleotide exchange factor for ADP-ribosylation factors. Genes Cells 11(8): 949-959, 2006. PMID: 16866877. DOI: 10.1111/j.1365-2443.2006.00991.x
    OpenUrlCrossRefPubMed
  40. ↵
    1. Jung HC and
    2. Kim K
    : Identification of MYCBP as a beta-catenin/LEF-1 target using DNA microarray analysis. Life Sci 77(11): 1249-1262, 2005. PMID: 15979100. DOI: 10.1016/j.lfs.2005.02.009
    OpenUrlCrossRefPubMed
  41. ↵
    1. Waterman ML,
    2. Fischer WH and
    3. Jones KA
    : A thymus-specific member of the HMG protein family regulates the human T cell receptor C alpha enhancer. Genes Dev 5(4): 656-669, 1991. PMID: 2010090. DOI: 10.1101/gad.5.4.656
    OpenUrlAbstract/FREE Full Text
  42. ↵
    1. van Genderen C,
    2. Okamura RM,
    3. Fariñas I,
    4. Quo RG,
    5. Parslow TG,
    6. Bruhn L and
    7. Grosschedl R
    : Development of several organs that require inductive epithelial-mesenchymal interactions is impaired in LEF-1-deficient mice. Genes Dev 8(22): 2691-2703, 1994. PMID: 7958926. DOI: 10.1101/gad.8.22.2691
    OpenUrlAbstract/FREE Full Text
  43. ↵
    1. Lehrer S,
    2. Rheinstein PH and
    3. Rosenzweig KE
    : Loss of MycBP may be associated with the improved survival in 1P co-deletion of lower grade glioma patients. Clin Neurol Neurosurg 172: 112-115, 2018. PMID: 29986195. DOI: 10.1016/j.clineuro.2018.07.003
    OpenUrlCrossRefPubMed
  44. ↵
    1. Li C,
    2. Tan F,
    3. Pei Q,
    4. Zhou Z,
    5. Zhou Y,
    6. Zhang L,
    7. Wang D and
    8. Pei H
    : Non-coding RNA MFI2-AS1 promotes colorectal cancer cell proliferation, migration and invasion through miR-574-5p/MYCBP axis. Cell Prolif 52(4): e12632, 2019. PMID: 31094023. DOI: 10.1111/cpr.12632
    OpenUrlCrossRefPubMed
  45. ↵
    1. Wang A,
    2. Zhang T,
    3. Wei W,
    4. Wang H,
    5. Zhang Z,
    6. Yang W,
    7. Xia W,
    8. Mao Q,
    9. Xu L,
    10. Jiang F and
    11. Dong G
    : The long noncoding RNA LINC00665 facilitates c-Myc transcriptional activity via the miR-195-5p MYCBP axis to promote progression of lung adenocarcinoma. Front Oncol 11: 666551, 2021. PMID: 34277412. DOI: 10.3389/fonc.2021.666551
    OpenUrlCrossRefPubMed
  46. ↵
    1. Mintz L,
    2. Galperin E,
    3. Pasmanik-Chor M,
    4. Tulzinsky S,
    5. Bromberg Y,
    6. Kozak CA,
    7. Joyner A,
    8. Fein A and
    9. Horowitz M
    : EHD1 – an EH-domain-containing protein with a specific expression pattern. Genomics 59(1): 66-76, 1999. PMID: 10395801. DOI: 10.1006/geno.1999.5800
    OpenUrlCrossRefPubMed
    1. Pohl U,
    2. Smith JS,
    3. Tachibana I,
    4. Ueki K,
    5. Lee HK,
    6. Ramaswamy S,
    7. Wu Q,
    8. Mohrenweiser HW,
    9. Jenkins RB and
    10. Louis DN
    : EHD2, EHD3, and EHD4 encode novel members of a highly conserved family of EH domain-containing proteins. Genomics 63(2): 255-262, 2000. PMID: 10673336. DOI: 10.1006/geno.1999.6087
    OpenUrlCrossRefPubMed
  48. ↵
    1. Naslavsky N and
    2. Caplan S
    : C-terminal EH-domain-containing proteins: consensus for a role in endocytic trafficking, EH? J Cell Sci 118(Pt 18): 4093-4101, 2005. PMID: 16155252. DOI: 10.1242/jcs.02595
    OpenUrlAbstract/FREE Full Text
  49. ↵
    1. Naslavsky N and
    2. Caplan S
    : EHD proteins: key conductors of endocytic transport. Trends Cell Biol 21(2): 122-131, 2011. PMID: 21067929. DOI: 10.1016/j.tcb.2010.10.003
    OpenUrlCrossRefPubMed
  50. ↵
    1. Simone LC,
    2. Naslavsky N and
    3. Caplan S
    : Scratching the surface: actin’ and other roles for the C-terminal Eps15 homology domain protein, EHD2. Histol Histopathol 29(3): 285-292, 2014. PMID: 24347515. DOI: 10.14670/HH-29.285
    OpenUrlCrossRefPubMed
  51. ↵
    1. Guilherme A,
    2. Soriano NA,
    3. Bose S,
    4. Holik J,
    5. Bose A,
    6. Pomerleau DP,
    7. Furcinitti P,
    8. Leszyk J,
    9. Corvera S and
    10. Czech MP
    : EHD2 and the novel EH domain binding protein EHBP1 couple endocytosis to the actin cytoskeleton. J Biol Chem 279(11): 10593-10605, 2004. PMID: 14676205. DOI: 10.1074/jbc.M307702200
    OpenUrlAbstract/FREE Full Text
    1. George M,
    2. Ying G,
    3. Rainey MA,
    4. Solomon A,
    5. Parikh PT,
    6. Gao Q,
    7. Band V and
    8. Band H
    : Shared as well as distinct roles of EHD proteins revealed by biochemical and functional comparisons in mammalian cells and C. elegans. BMC Cell Biol 8: 3, 2007. PMID: 17233914. DOI: 10.1186/1471-2121-8-3
    OpenUrlCrossRefPubMed
    1. Doherty KR,
    2. Demonbreun AR,
    3. Wallace GQ,
    4. Cave A,
    5. Posey AD,
    6. Heretis K,
    7. Pytel P and
    8. McNally EM
    : The endocytic recycling protein EHD2 interacts with myoferlin to regulate myoblast fusion. J Biol Chem 283(29): 20252-20260, 2008. PMID: 18502764. DOI: 10.1074/jbc.M802306200
    OpenUrlAbstract/FREE Full Text
  54. ↵
    1. Benjamin S,
    2. Weidberg H,
    3. Rapaport D,
    4. Pekar O,
    5. Nudelman M,
    6. Segal D,
    7. Hirschberg K,
    8. Katzav S,
    9. Ehrlich M and
    10. Horowitz M
    : EHD2 mediates trafficking from the plasma membrane by modulating Rac1 activity. Biochem J 439(3): 433-442, 2011. PMID: 21756249. DOI: 10.1042/BJ20111010
    OpenUrlAbstract/FREE Full Text
  55. ↵
    1. Pekar O,
    2. Benjamin S,
    3. Weidberg H,
    4. Smaldone S,
    5. Ramirez F and
    6. Horowitz M
    : EHD2 shuttles to the nucleus and represses transcription. Biochem J 444(3): 383-394, 2012. PMID: 22448906. DOI: 10.1042/BJ20111268
    OpenUrlAbstract/FREE Full Text
  56. ↵
    1. Horton P and
    2. Nakai K
    : Better prediction of protein cellular localization sites with the k nearest neighbors classifier. Proc Int Conf Intell Syst Mol Biol 5: 147-152, 1997. PMID: 9322029.
    OpenUrlPubMed
  57. ↵
    1. Thumuluri V,
    2. Almagro Armenteros JJ,
    3. Johansen AR,
    4. Nielsen H and
    5. Winther O
    : DeepLoc 2.0: multi-label subcellular localization prediction using protein language models. Nucleic Acids Res 50(W1): W228-W234, 2022. PMID: 35489069. DOI: 10.1093/nar/gkac278
    OpenUrlCrossRefPubMed
  58. ↵
    1. Miyoshi H,
    2. Ohira M,
    3. Shimizu K,
    4. Mitani K,
    5. Hirai H,
    6. Imai T,
    7. Yokoyama K,
    8. Soeda E and
    9. Ohki M
    : Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia. Nucleic Acids Res 23(14): 2762-2769, 1995. PMID: 7651838. DOI: 10.1093/nar/23.14.2762
    OpenUrlCrossRefPubMed
    1. Ghozi MC,
    2. Bernstein Y,
    3. Negreanu V,
    4. Levanon D and
    5. Groner Y
    : Expression of the human acute myeloid leukemia gene AML1 is regulated by two promoter regions. Proc Natl Acad Sci USA 93(5): 1935-1940, 1996. PMID: 8700862. DOI: 10.1073/pnas.93.5.1935
    OpenUrlAbstract/FREE Full Text
  60. ↵
    1. Martinez M,
    2. Hinojosa M,
    3. Trombly D,
    4. Morin V,
    5. Stein J,
    6. Stein G,
    7. Javed A and
    8. Gutierrez SE
    : Transcriptional auto-regulation of RUNX1 P1 promoter. PLoS One 11(2): e0149119, 2016. PMID: 26901859. DOI: 10.1371/journal.pone.0149119
    OpenUrlCrossRefPubMed
  61. ↵
    1. Levanon D,
    2. Bernstein Y,
    3. Negreanu V,
    4. Ghozi MC,
    5. Bar-Am I,
    6. Aloya R,
    7. Goldenberg D,
    8. Lotem J and
    9. Groner Y
    : A large variety of alternatively spliced and differentially expressed mRNAs are encoded by the human acute myeloid leukemia gene AML1. DNA Cell Biol 15(3): 175-185, 1996. PMID: 8634147. DOI: 10.1089/dna.1996.15.175
    OpenUrlCrossRefPubMed
  62. ↵
    1. Telfer JC and
    2. Rothenberg EV
    : Expression and function of a stem cell promoter for the murine CBFalpha2 gene: distinct roles and regulation in natural killer and T cell development. Dev Biol 229(2): 363-382, 2001. PMID: 11203699. DOI: 10.1006/dbio.2000.9991
    OpenUrlCrossRefPubMed
    1. Fujita Y,
    2. Nishimura M,
    3. Taniwaki M,
    4. Abe T and
    5. Okuda T
    : Identification of an alternatively spliced form of the mouse AML1/RUNX1 gene transcript AML1c and its expression in early hematopoietic development. Biochem Biophys Res Commun 281(5): 1248-1255, 2001. PMID: 11243869. DOI: 10.1006/bbrc.2001.4513
    OpenUrlCrossRefPubMed
    1. Pozner A,
    2. Lotem J,
    3. Xiao C,
    4. Goldenberg D,
    5. Brenner O,
    6. Negreanu V,
    7. Levanon D and
    8. Groner Y
    : Developmentally regulated promoter-switch transcriptionally controls Runx1 function during embryonic hematopoiesis. BMC Dev Biol 7: 84, 2007. PMID: 17626615. DOI: 10.1186/1471-213X-7-84
    OpenUrlCrossRefPubMed
    1. Sroczynska P,
    2. Lancrin C,
    3. Kouskoff V and
    4. Lacaud G
    : The differential activities of Runx1 promoters define milestones during embryonic hematopoiesis. Blood 114(26): 5279-5289, 2009. PMID: 19858498. DOI: 10.1182/blood-2009-05-222307
    OpenUrlAbstract/FREE Full Text
  66. ↵
    1. Medina MA,
    2. Ugarte GD,
    3. Vargas MF,
    4. Avila ME,
    5. Necuñir D,
    6. Elorza AA,
    7. Gutiérrez SE and
    8. De Ferrari GV
    : Alternative RUNX1 promoter regulation by Wnt/β-catenin signaling in leukemia cells and human hematopoietic progenitors. J Cell Physiol 231(7): 1460-1467, 2016. PMID: 26580584. DOI: 10.1002/jcp.25258
    OpenUrlCrossRefPubMed
  67. ↵
    1. Zhou TH,
    2. Su JZ,
    3. Qin R,
    4. Chen X,
    5. Ju GD and
    6. Miao S
    : Prognostic and predictive value of a 15 transcription factors (TFs) panel for hepatocellular carcinoma. Cancer Manag Res 12: 12349-12361, 2020. PMID: 33293862. DOI: 10.2147/CMAR.S279194
    OpenUrlCrossRefPubMed
  68. ↵
    1. Takeuchi Y,
    2. Yoshida K,
    3. Halik A,
    4. Kunitz A,
    5. Suzuki H,
    6. Kakiuchi N,
    7. Shiozawa Y,
    8. Yokoyama A,
    9. Inoue Y,
    10. Hirano T,
    11. Yoshizato T,
    12. Aoki K,
    13. Fujii Y,
    14. Nannya Y,
    15. Makishima H,
    16. Pfitzner BM,
    17. Bullinger L,
    18. Hirata M,
    19. Jinnouchi K,
    20. Shiraishi Y,
    21. Chiba K,
    22. Tanaka H,
    23. Miyano S,
    24. Okamoto T,
    25. Haga H,
    26. Ogawa S and
    27. Damm F
    : The landscape of genetic aberrations in myxofibrosarcoma. Int J Cancer 151(4): 565-577, 2022. PMID: 35484982. DOI: 10.1002/ijc.34051
    OpenUrlCrossRefPubMed
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Novel MYCBP::EHD2 and RUNX1::ZNF780A Fusion Genes in T-cell Acute Lymphoblastic Leukemia
IOANNIS PANAGOPOULOS, KRISTIN ANDERSEN, INGA MARIA RINVOLL JOHANNSDOTTIR, FRANCESCA MICCI, SVERRE HEIM
Cancer Genomics & Proteomics Jan 2023, 20 (1) 51-63; DOI: 10.21873/cgp.20364
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

Keywords