Research ArticleArticles
Open Access

A Novel Cryptic t(2;3)(p21;q25) Translocation Fuses the WWTR1 and PRKCE Genes in Uterine Leiomyoma With 3q- as the Sole Visible Chromosome Abnormality

IOANNIS PANAGOPOULOS, KRISTIN ANDERSEN, LUDMILA GORUNOVA, BEN DAVIDSON, FRANCESCA MICCI and SVERRE HEIM
Cancer Genomics & Proteomics September 2022, 19 (5) 636-646; DOI: https://doi.org/10.21873/cgp.20348

Abstract

Background/Aim: Deletions in the q arm of chromosome 3 have been reported in uterine leiomyomas, also as sole anomalies. Because some neoplasia-associated deletions may give rise to tumorigenic fusion genes, we chose to investigate thoroughly one such tumor. Materials and Methods: A uterine leiomyoma obtained from a 45-year-old woman had the karyotype 46,XX,del(3)(q?)[11]. The tumor was further studied using array comparative genomic hybridization, RNA sequencing, reverse transcription polymerase chain reaction, Sanger sequencing, and fluorescence in situ hybridization methodologies. Results: The deletion was shown to be from 3q22.2 to 3q26.32. Unexpectedly, a cryptic balanced t(2;3)(p21;q25) translocation was also found affecting two otherwise normal chromosomes 2 and 3, i.e., the der(3)t(2;3) was not the deleted chromosome 3. The translocation generated two chimeras between the genes WW domain containing transcription regulator 1 (WWTR1) from 3q25.1 and protein kinase C epsilon (PRKCE) from 2p21. The WWTR1::PRKCE fusion would code for a chimeric serine/threonine kinase, whereas the reciprocal PRKCE::WWTR1 fusion would code for a chimeric transcriptional coactivator protein. Conclusion: Leiomyomas carrying a deletion on 3q may also have a balanced t(2;3)(p21;q25) leading to fusion of WWTR1 with PRKCE.

Key Words:

Uterine leiomyomas or fibroids are the most common neoplasms found in more than 70% of women during their reproductive age and later (1, 2). In 30% to 50% of patients, the tumors may cause menorrhagia (heavy menstrual bleeding), pelvic pain/pressure, infertility and other morbidities (1) that affect the quality of life (3, 4). Uterine leiomyomas are benign monoclonal tumors (5) arising from a single myometrial stem cell that, by acquiring somatic mutations, has been transformed into a neoplastic stem cell capable of development into a leiomyoma (5-7).

Cytogenetic examinations of uterine leiomyomas have revealed that 25-40% of them carry nonrandom chromosome aberrations, the most common of which is the translocation t(12;14)(q14~15;q23~24) found in 15-20% of karyotypically abnormal leiomyomas (8-27). A small number of uterine leiomyomas are cytogenetically characterized by a deletion of the q arm of chromosome 3 (10, 11, 15, 21, 22, 28). We present here our molecular findings in a leiomyoma carrying a deletion on 3q.

Materials and Methods

Ethics statement. The study was approved by the Regional committee for medical and health research ethics. Written informed consent was obtained from the patient for publication of the case details. The ethics committee’s approval included a review of the consent procedure. All patient information has been de-identified.

Tumor description and Immunohistochemistry. A 45-year-old woman underwent surgery because of a clinical diagnosis of leiomyoma. The weight of the hysterectomy specimen, with attached adnexae, was 1.9 kg. A 17 cm in diameter leiomyomatous tumor was seen in the uterus. Microscopic evaluation showed a smooth muscle tumor (Figure 1A) with no evidence of atypia (Figure 1B), increased mitotic activity or necrosis. Some areas with degenerative changes were seen. Desmin immunostaining was performed using a monoclonal mouse antibody (clone D33) from Dako/Agilent (Glostrup, Denmark) using the Dako EnVision Flex + System (K8012; Dako). A 1:30 dilution with antigen retrieval at HpH was applied. Immunohistochemical staining showed expression of desmin (Figure 1C). The tumor was diagnosed as leiomyoma.

Figure 1.
Figure 1.

Microscopic examination of the uterine leiomyoma. (A) Hematoxylin and eosin (H&E) stained section showing a smooth muscle tumor with varying degree of cellularity; scale bar represents 100 μm. (B) H&E staining showing smooth muscle cells with no evidence of atypia or increased mitotic activity; scale bar represents 50 μm. (C) Immunohistochemical staining showing expression of desmin in the uterine leiomyoma; scale bar represents 100 μm.

G-banding and karyotyping. Fresh tissue from the tumor was minced using scalpels into 1-2 mm fragments, enzymatically disaggregated using collagenase II (Worthington, Freehold, NJ, USA), and the resulting cells were cultured, harvested, and processed for cytogenetic examination (29). Chromosome preparations were G-banded with Wright’s stain (Sigma-Aldrich; St Louis, MO, USA) and examined (29). The karyotype was written according to The International System for Human Cytogenomic Nomenclature (ISCN) 2016 guidelines (30).

Array comparative genomic hybridization (aCGH). Genomic DNA was extracted from the tumor using the Maxwell RSC Instrument and Maxwell RSC Tissue DNA Kit (Promega, Madison, USA). The concentration was measured with the Quantus Fluorometer and the QuantiFluor ONE dsDNA System (Promega). Promega’s human genomic female DNA was used as reference DNA. aCGH was performed using CytoSure array products (Oxford Gene Technology, Begbroke, Oxfordshire, UK) according to the company’s protocols. Thus, the CytoSure Genomic DNA Labelling Kit was used for the labelling of 1 μg of each of tumor and reference DNA and the CytoSure Cancer +SNP array for hybridization. The slides were scanned in an Agilent SureScan Dx microarray scanner using Agilent Feature Extraction Software (version 12.1.1.1). Data were analyzed with the CytoSure Interpret analysis software (version 4.9.40). Annotations are based on human genome build 19.

RNA sequencing. Total RNA was extracted from a frozen (-80 °C) part of the specimen adjacent to areas used for cytogenetic analysis and histologic examination using miRNeasy Mini Kit (Qiagen, Hilden, Germany). One μg of total RNA was sent to the Genomics Core Facility at the Norwegian Radium Hospital, Oslo University Hospital for high-throughput paired-end RNA-sequencing and a total of 185×106 101-bp-length-reads were obtained. The FASTQC software was used for quality control of the raw sequence data (available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Fusion transcripts were found using the FusionCatcher software (31, 32).

Reverse transcription (RT) PCR and Sanger sequencing. In order to confirm the existence of the fusion transcripts (see below), RT-PCR and Sanger sequencing analyses were performed. The primers used for PCR amplifications and Sanger sequencing are shown in Table I. Detailed information on synthesis of cDNA, PCR amplification, and Sanger sequencing methodologies were given elsewhere (33).

View this table:
Table I.

Designation, sequence (5’->3’), and position in reference sequences of the forward (F) and reverse (R) primers of the WW domain containing transcription regulator 1 (WWTR1) and the protein kinase C epsilon (PRKCE) genes which were used for polymerase chain reaction (PCR) amplification and Sanger sequencing analyses. For Sanger sequencing analyses the forward primers WWTR1-1002F1 and PRKCE-710F1 had the M13 forward primer sequence TGTAAAACGACGGCCAGT at their 5’-end. The reverse primers PRKCE-862R1 and WWTR1-1171R1 the M13 reverse primer sequence CAGGAAACAGCTATGACC had at their 5’-end.

The sequences obtained by Sanger sequencing were compared with the NCBI reference sequences NM_015472.4 [WW domain containing transcription regulator 1 (WWTR1), transcript variant 1, mRNA] and NM_005400.3 [protein kinase C epsilon (PRKCE), mRNA] using the Basic Local Alignment Search Tool (BLAST) (34). They were also aligned on the Human GRCh37/hg19 assembly using the BLAST-like alignment tool (BLAT) and the human genome browser hosted by the University of California, Santa Cruz (35, 36).

Fluorescence in situ hybridization (FISH). Both metaphase plates and interphase nuclei were examined using the ZytoLight SPEC WWTR1 Dual Color Break Apart Probe (Zytovision, Bremerhaven, Germany). The probe is designed for detection of translocations involving the chromosomal area 3q25.1 harboring the WWTR1 gene and is a mixture of green and orange fluorochrome-labeled probes that hybridize to proximal and distal parts of the WWTR1 gene, respectively. According to the human genome assembly GRCh37/hg19, the green-labeled part hybridizes to chr3:148533200-149234601 whereas the orange-labeled part hybridizes to chr3:149430325-149933565. Also, a homemade double fusion FISH probe was used to detect the fusion of WWTR1 with PRKCE. BAC probes were purchased from the BACPAC Resource Center operated by BACPAC Genomics, Emeryville, CA (https://bacpacresources.org/) (Table II). The FISH probes were prepared from bacteriophage Phi29 DNA polymerase amplified BAC DNAs using previously described methodology (37) and kits for DNA isolation, amplification, labelling and hybridization, all according to the manufacturers’ recommendations. In brief, single isolated bacterial colonies were grown in 5 ml culture overnight and BAC DNA was purified from them using High Pure Plasmid Isolation Kit (Roche Diagnostics, Mannheim, Germany). Following purification, BAC DNAs were isothermally amplified with Phi29 DNA polymerase using the GenomiPhi V2 DNA Amplification Kit (Cytiva, Marlborough, MA, USA). Finally, amplified BAC DNAs were labelled and hybridized using Abbott’s nick translation kit (Abbott Molecular, Des Plaines, IL, USA). The probes for WWTR1 were labelled with Texas Red-5-dCTP (PerkinElmer, Boston, MA, USA) to obtain a red signal. The probes for PRKCE were labelled with fluorescein-12-dCTP (PerkinElmer) to obtain a green signal. Mapping of the clones on normal controls was performed to confirm their chromosomal location. The probe for PRKCE was found to cross-hybridize to the p arm of chromosome 16. However, this cross-hybridization did not interfere with the interpretation. Detailed information on the FISH procedure has been given elsewhere (33, 38). Fluorescent signals were captured and analyzed using the CytoVision system (Leica Biosystems, Newcastle, UK).

View this table:
Table II.

BAC probes used for fluorescence in situ hybridization (FISH) experiments to detect the fusion genes. The position and the accession numbers of the PRKCE and WWTR1 genes are also given.

Results

Cytogenetics and aCGH analyses. The initial G-banding analysis revealed a deletion on the long arm of chromosome 3 in all eleven examined metaphases but neither the breakpoint(s) region nor band(s) could be identified. Thus, the karyotype was described as 46,XX,del(3)(q?)[11]. In order to map the deletion on 3q, aCGH was performed that showed a 44 Mbp interstitial deletion from q22.2 to q26.32 (Figure 2A). On 3q22.2, the deletion started within intron 1 of the EPH receptor B1 (EPHB1) gene (Figure 2B) whereas it ended on 3q26.32 between the two genes potassium calcium-activated channel subfamily M regulatory beta subunit 2 (KCNMB2), which was included in the deletion, and zinc finger matrin-type 3 (ZMAT3) which was distal to the deletion (Figure 2C). The deleted region includes more than 150 genes, among them WWTR1 (chr3:149,235,022-149,375,812) (Figure 2A).

Figure 2.
Figure 2.

Array comparative genomic hybridization examination of the uterine leiomyoma. (A) Genetic profile of whole chromosome 3 showing the deletion in the q arm of chromosome 3. Based on the hg19 assembly, the deletion started at position Chr3:134625401 on subband q22.2 and ended at Chr3:178622327 on subband q26.32. (B) The deletion started within intron 1 of the EPH receptor B1 (EPHB1) gene. (C) The deletion ended between the two genes of potassium calcium-activated channel subfamily M regulatory beta subunit 2 (KCNMB2), included in the deletion, and zinc finger matrin-type 3 (ZMAT3), distal to the deletion.

RNA sequencing, RT-PCR, and Sanger sequencing analyses Analysis of raw sequencing data using FusionCatcher detected reciprocal in-frame fusion transcripts of WWTR1 from chromosome subband 3q25.1 with PRKCE from chromosome band 2p21. In the WWTR1::PRKCE transcript, exon 4 of WWTR1 (nucleotide 1111 in sequence NM_015472.4) fused with exon 2 of PRKCE (nucleotide 775 in sequence NM_005400.3): GAGAGAAAGGATTCG AATGCGCCAAGAGGAGCTCATGAGGCAG*ATTGATCT GGAGCCAGAAGGAAGAGTGTATGTGATCATCGATC. In the PRKCE::WWTR1 transcript, exon 1 of PRKCE (nucleotide 774 in sequence NM_005400.3) fused to exon 5 of WWTR1 (nucleotide 1112 in sequence NM_015472.4): TGAGGAGCTGCTGCAGAACGGGAGCCGCCACTTCGA GGACTGG*GAAGCTGCCCTCTGTCGACAGCTCCCCAT GGAAGCTGAGACTC.

RT-PCR using WWTR1-996F1 and PRKCE-904R1 primer combinations amplified a 268 bp cDNA fragment (Figure 3A) which by Sanger sequencing was shown to confirm the WWTR1::PRKCE fusion transcript detected by RNA sequencing/FusionCatcher analysis (Figure 3B). RT-PCR with PRKCE-700F1 and WWTR1-1188R1 primers amplified a 174 bp cDNA fragment (Figure 3C) which by Sanger sequencing was shown to confirm the PRKCE::WWTR1 fusion transcript detected by RNA sequencing/FusionCatcher (Figure 3D).

Figure 3.
Figure 3.

Reverse transcription polymerase chain reaction (RT-PCR), Sanger sequencing, and fluorescence in situ hybridization (FISH) examination of the uterine leiomyoma. (A) Gel electrophoresis showing the amplified 268 bp cDNA fragment using the forward primer WWTR1-996F1 together with the reverse PRKCE-904R1 primer. (B) Partial Sanger sequencing chromatogram of the amplified 268 bp cDNA fragment showing the junction between exon 4 of WWTR1 and exon 2 of PRKCE. (C) Gel electrophoresis showing the amplified 174 bp cDNA fragment using the forward PRKCE-700F1 and reverse WWTR1-1188R1 primers. (D) Partial Sanger sequencing chromatogram of the amplified 174 bp cDNA fragment showing the junction between exon 1 of PRKCE and exon 5 of WWTR1. (E) FISH with a commercial WWTR1 dual color break-apart probe on a metaphase spread showing that the proximal part of the probe (green signal) hybridized to a seemingly normal chromosome 3 signed as der(3), whereas the distal part of the probe (red signal) hybridized to a seemingly normal chromosome 2, signed as der(2). The orange/green fusion signal, which indicates a normal WWTR1 locus, is absent. (F) FISH with a homemade WWTR1::PRKCE dual color dual fusion probe on a metaphase spread showing two red/green fusion signals, one on a der(2) and the other on der(3), indicating the presence of WWTR1::PRKCE and the reciprocal PRKCE::WWTR1 on those chromosomes, respectively. Three green signals for the PRKCE are also shown: one on the p arm of normal chromosome 2 representing the PRKCE locus, and two cross-hybridized signals on chromosomes 16. The red signal corresponding to the normal WWTR1 locus on 3q25.1 is absent.

FISH analyses. Using the commercially available WWTR1 dual color break apart probe on metaphase spreads, the proximal green-labeled part of the probe hybridized on the q arm of a seemingly normal chromosome 3 whereas the distal orange-labeled part of the probe hybridized on the p arm of a seemingly normal chromosome 2 (Figure 3E). Orange/green fusion signal representing normal (non-rearranged) WWTR1 on 3q25 was absent, corresponding to the deletion seen by G-banding and aCGH.

Hybridization with a homemade double fusion WWTR1::PRKCE FISH probe detected a green signal corresponding to PRKCE on chromosome band 2p21 and two green/red fusion signals on seemingly normal chromosomes 2 and 3 corresponding to the WWTR1::PRKCE (on 2p21) and PRKCE::WWTR1 (on 3q25.1) reciprocal fusion genes (Figure 3F). The red signal corresponding to the WWTR1 normal locus on 3q25.1 was absent (Figure 3F). Two green signals on the p arms of both chromosomes 16, highlighted by cross-hybridization of the PRKCE probe, were also seen (Figure 3F). This cross-hybridization did not interfere with data interpretation.

Corrected karyotype. Based on the findings in the above-mentioned experiments, the new and corrected karyotype of the examined uterine leiomyoma became: 46,XX,t(2;3)(p21;q25), del(3)(q22q26).

Discussion

In the present study, we genetically analyzed a uterine leiomyoma which, in the initial cytogenetic examination, had a deletion of the q arm of one chromosome 3. The deletion’s exact position and extent could not be determined by G-banding. The rationale behind our decision to examine the tumor further was that deletions sometimes generate fusion genes (33, 39).

By aCGH, the deletion was found to correspond to a del(3)(q22.2q26.32) that did not result in any fusion gene but caused allelic loss of more than 150 genes, among them WWTR1 (Figure 2). Further examinations by a combination of RNA sequencing, RT-PCR/Sanger sequencing, and FISH methodologies then revealed a cryptic, balanced t(2;3) (p21;q25) translocation affecting the two seemingly normal (i.e., non-deleted) chromosomes 2 and 3 (Figure 4). This translocation resulted in the fusion of the 5’-part of WWTR1 (exons 1 to 4) with the 3’-part of PRKCE (exons 2 to 15) on der(2)t(2;3)(p21;q25) and fusion of the 5’-part of PRKCE (exon 1) with the 3’-part of WWTR1 (exons 5 to 7) on der(3)t(2;3)(p21;q25) (Figure 4). The t(2;3)(p21;q25) translocation is, to the best of our knowledge, novel; at least it is not listed among the chromosome aberrations of 72718 karyotypically abnormal neoplasms registered in the “Mitelman database of chromosome aberrations and gene fusions in cancer” (last updated on June 6, 2022) (40). Searching the same database and the literature on leiomyoma cytogenetics, we found, in addition to the present case, twelve more uterine leiomyomas reported to carry a deletion in the 3q arm (Table III) (10, 11, 15, 16, 21, 22, 41, 42). Partial karyotypes of the seemingly normal, non-deleted chromosome 3 together with 3q- were provided for some tumors, but because der(3)t(2;3)(p21;q25) is practically indistinguishable by inspection from a normal chromosome 3 even in good preparations, we cannot know whether a t(2;3)(p21;q25) existed in some of those cases (10, 16, 21, 41). It is therefore possible that at least some of the tumors carrying a deletion on 3q as what seemed to be a solitary aberration, were genetically similar to the tumor of the present study with loss of one WWTR1 allele due to deletion occurring together with a cryptic t(2;3)(p21;q25) that gave rise to the two reciprocal fusion genes WWTR1::PRKCE and PRKCE::WWTR1. Alternatively, the simultaneous presence of both del(3q) and t(2;3) could be a fluke event without the existence of any contributory pathogenetic effect of one aberration on the other.

Figure 4.
Figure 4.

Chromosomal aberrations detected in uterine leiomyoma. (A) Partial karyotype showing the seemingly normal chromosome 2 which was actually a der(2)t(2;3)(p21;q25), the normal chromosome 2, the seemingly normal chromosome 3, which was actually a der(3)t(2;3)(p21;q25), and the chromosome 3 carrying the deletion on its q arm eventually identified as del(3)(q22q26). Arrows indicating breakpoints were placed upon re-evaluation of the karyotype based on G-banding, aCGH, RNA sequencing, RT-PCR/Sanger sequencing, and FISH results. (B) Ideogram showing a der(2)t(2;3)(p21;q25) carrying the 5’-WWTR1::PRKCE-3’ fusion gene, a normal chromosome 2, a der(3)t(2;3)(p21;q25) carrying the 5’-PRKCE::WWTR1-3’ gene, and a del(3)(q22.2q26.3). (C) A normal chromosome 3 from a uterine leiomyoma. (D) Ideogram of a normal chromosome 3 showing the position of WWTR1 on subband 3q25.1 (red line) and the q22q26 part (orange box).

View this table:
Table III.

Published uterine leiomyomas carrying deletion on q arm of chromosome 3 and present case. Age of patients and abnormal karyotypes were obtained from Mitelman database of chromosome aberrations and gene fusions in cancer.

The WWTR1 gene codes for a transcription factor which is involved in the Hippo signaling pathway (43, 44). The WWTR1 protein contains an N-terminal region which interacts with the TEAD family of transcription factors, a 14-3-3 binding site, a WW-domain, a transcription activation domain, and, at the C-terminal end, a conserved PDZ-domain (45-47). WWTR1 has been reported to fuse, as a 5’-end partner in various tumors (48-54). In epithelioid hemangioendothelioma, WWTR1 fuses with the genes calmodulin binding transcription activator 1 (CAMTA1 on 1p36), actin like 6A (ACTL6A on 3q26), and mastermind like transcriptional coactivator 2 (MAML2 on 11q21) (48-50). In epithelioid hemangioma (50, 51) and pseudomyogenic hemangioendothelioma (52), it fuses with FosB proto-oncogene and AP-1 transcription factor subunit (FOSB on 19q13). In poroma, WWTR1 fuses with NUT midline carcinoma family member 1 (NUTM1 on 15q14) (53) and in an intra-abdominal sarcoma associated with endometriosis it fuses with AF4/FMR2 family member 2 (AFF2 on Xq28) (54).

PRKCE codes for a serine- and threonine-specific protein kinase which is a member of the protein kinase C (PKC) family (55, 56). According to the human protein atlas, PRKCE is expressed in many tissues with high levels in the brain and lung (https://www.proteinatlas.org/). It plays a role in a number of biological processes including apoptosis and cardioprotection from ischemia (56, 57) (see also https://www.ncbi.nlm.nih.gov/gene/5581). In cancer, PRKCE was found to behave as an oncogene in tumor invasion and metastasis (58, 59). The PRKCE protein has an N-terminal region, a hinge, and a C-terminal region (56). The N-terminal region is the regulatory part of the protein. It contains a calcium-independent C2 domain (location on NP_005391.1: 3-135) (60) which binds to phospholipid activators, RACK scaffolding protein, and the HSP90 chaperone protein. It also contains a C1 domain (location on NP_005391.1: 161-295) (61) which binds to second messengers diacylglycerol, fatty acids, and phorbol esters as well as to filamentous actin (56, 57). The C-terminal part is the catalytic domain of the serine/threonine kinase having an ATP binding site and the activation loop (location on NP_005391.1: 412-732) (56, 57).

Thus, the WWTR1::PRKCE fusion transcript would code for an 878 amino acid long chimeric serine/threonine kinase. The first 257 amino acids would contain the N-terminal region interacting with the TEAD family of transcription factors, the 14-3-3 binding region, and the WW domain from the WWTR1 protein, whereas the last 621 amino acids of the chimeric protein contain the C1 domain and the catalytic domain of the serine/threonine kinase of PRKCE (Figure 5). The reciprocal PRKCE::WWTR1 fusion transcript would encode a chimeric transcriptional coactivator protein containing the N-terminal C2 domain of PRKCE and the transcription activation domain and conserved PDZ-domain of WWTR1 (Figure 5). Because the examined tumor does not have any normal WWTR1 allele - one is fused to the PRKCE locus whereas the second allele is lost through del(3)(q22q26) -, the involvement of WWTR1 in the hippo pathway must be exclusively via the two fusion proteins WWTR1::PRKCE and PRKCE::WWTR1 resulting in the pathway’s deregulation (Figure 5) (43, 47). In genetic terms, we seem to be facing an unusual situation in which tumorigenesis comes across as a recessive trait at the cellular level, at least as far as the hippo pathway is concerned. The alternative, less exciting possibility would be that the del(3q) was a coincidental change adding little or nothing from the pathogenetic point of view. Only future studies of tumors having these genomic changes, 3q- and/or the 2;3-translocation, can clarify their relative tumorigenic importance.

Figure 5.
Figure 5.

The chimeric WWTR1::PRKCE and PRKCE::WWTR1 proteins. The fusion point is in bold and underlined. The different domains and binding sites are colored.

In conclusion, by combining analyses by G-banding, aCGH, RNA sequencing, RT-PCR, Sanger sequencing, and FISH methodologies a leiomyoma whose only genomic change initially seemed to be an interstitial deletion on the long arm of chromosome 3, turned out to carry also a novel cryptic balanced t(2;3)(p21;q25) which generated reciprocal WWTR1::PRKCE and PRKCE::WWTR1 chimeras. The karyotype of the leiomyoma was corrected to 46,XX,t(2;3)(p21;q25), del(3)(q22q26). We believe that at least some of the reported leiomyomas with del(3q) in the cytogenetic literature are genetically similar to the case just described.

Acknowledgements

This study was supported by grants from Radiumhospitalets Legater.

Footnotes

  • Authors’ Contributions

    IP designed and supervised the research, performed molecular genetic experiments, bioinformatics analysis, and wrote the manuscript. KA performed fluorescence in situ hybridization, molecular genetic methods and interpreted the data. LG performed cytogenetic analysis. BD performed the pathological examination. FM evaluated the data. SH assisted with experimental design and writing of the manuscript. All Authors read and approved of the final manuscript.

  • Conflicts of Interest

    The Authors declare that they have no potential conflicts of interest.

  • Received June 21, 2022.
  • Revision received July 15, 2022.
  • Accepted July 18, 2022.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).

References

  1. ↵
    1. Zimmermann A,
    2. Bernuit D,
    3. Gerlinger C,
    4. Schaefers M and
    5. Geppert K
    : Prevalence, symptoms and management of uterine fibroids: an international internet-based survey of 21,746 women. BMC Womens Health 12: 6, 2012. PMID: 22448610. DOI: 10.1186/1472-6874-12-6
    OpenUrlCrossRefPubMed
  2. ↵
    1. Stewart EA,
    2. Cookson CL,
    3. Gandolfo RA and
    4. Schulze-Rath R
    : Epidemiology of uterine fibroids: a systematic review. BJOG 124(10): 1501–1512, 2017. PMID: 28296146. DOI: 10.1111/1471-0528.14640
    OpenUrlCrossRefPubMed
  3. ↵
    1. Soliman AM,
    2. Margolis MK,
    3. Castelli-Haley J,
    4. Fuldeore MJ,
    5. Owens CD and
    6. Coyne KS
    : Impact of uterine fibroid symptoms on health-related quality of life of US women: evidence from a cross-sectional survey. Curr Med Res Opin 33(11): 1971–1978, 2017. PMID: 28836862. DOI: 10.1080/03007995.2017.1372107
    OpenUrlCrossRefPubMed
  4. ↵
    1. Hervé F,
    2. Katty A,
    3. Isabelle Q and
    4. Céline S
    : Impact of uterine fibroids on quality of life: a national cross-sectional survey. Eur J Obstet Gynecol Reprod Biol 229: 32–37, 2018. PMID: 30099225. DOI: 10.1016/j.ejogrb.2018.07.032
    OpenUrlCrossRefPubMed
  5. ↵
    1. Holdsworth-Carson SJ,
    2. Zaitseva M,
    3. Vollenhoven BJ and
    4. Rogers PA
    : Clonality of smooth muscle and fibroblast cell populations isolated from human fibroid and myometrial tissues. Mol Hum Reprod 20(3): 250–259, 2014. PMID: 24243625. DOI: 10.1093/molehr/gat083
    OpenUrlCrossRefPubMed
    1. Mas A,
    2. Cervelló I,
    3. Gil-Sanchis C,
    4. Faus A,
    5. Ferro J,
    6. Pellicer A and
    7. Simón C
    : Identification and characterization of the human leiomyoma side population as putative tumor-initiating cells. Fertil Steril 98(3): 741–751.e6, 2012. PMID: 22633281. DOI: 10.1016/j.fertnstert.2012.04.044
    OpenUrlCrossRefPubMed
  7. ↵
    1. Yin P,
    2. Ono M,
    3. Moravek MB,
    4. Coon JS 5th.,
    5. Navarro A,
    6. Monsivais D,
    7. Dyson MT,
    8. Druschitz SA,
    9. Malpani SS,
    10. Serna VA,
    11. Qiang W,
    12. Chakravarti D,
    13. Kim JJ and
    14. Bulun SE
    : Human uterine leiomyoma stem/progenitor cells expressing CD34 and CD49b initiate tumors in vivo. J Clin Endocrinol Metab 100(4): E601–E606, 2015. PMID: 25658015. DOI: 10.1210/jc.2014-2134
    OpenUrlCrossRefPubMed
  8. ↵
    1. Heim S,
    2. Nilbert M,
    3. Vanni R,
    4. Floderus UM,
    5. Mandahl N,
    6. Liedgren S,
    7. Lecca U and
    8. Mitelman F
    : A specific translocation, t(12;14)(q14-15;q23-24), characterizes a subgroup of uterine leiomyomas. Cancer Genet Cytogenet 32(1): 13–17, 1988. PMID: 3355995. DOI: 10.1016/0165-4608(88)90305-6
    OpenUrlCrossRefPubMed
    1. Nilbert M,
    2. Heim S,
    3. Mandahl N,
    4. Flodérus UM,
    5. Willén H and
    6. Mitelman F
    : Karyotypic rearrangements in 20 uterine leiomyomas. Cytogenet Cell Genet 49(4): 300–304, 1988. PMID: 3248388. DOI: 10.1159/000132682
    OpenUrlCrossRefPubMed
  10. ↵
    1. Mark J,
    2. Havel G,
    3. Grepp C,
    4. Dahlenfors R and
    5. Wedell B
    : Chromosomal patterns in human benign uterine leiomyomas. Cancer Genet Cytogenet 44(1): 1–13, 1990. PMID: 2293875. DOI: 10.1016/0165-4608(90)90192-d
    OpenUrlCrossRefPubMed
  11. ↵
    1. Nilbert M,
    2. Heim S,
    3. Mandahl N,
    4. Flodérus UM,
    5. Willén H and
    6. Mitelman F
    : Characteristic chromosome abnormalities, including rearrangements of 6p, del(7q), +12, and t(12;14), in 44 uterine leiomyomas. Hum Genet 85(6): 605–611, 1990. PMID: 2227952. DOI: 10.1007/BF00193583
    OpenUrlCrossRefPubMed
    1. Nilbert M,
    2. Heim S,
    3. Mandahl N,
    4. Flodérus UM,
    5. Willén H and
    6. Mitelman F
    : Trisomy 12 in uterine leiomyomas. A new cytogenetic subgroup. Cancer Genet Cytogenet 45(1): 63–66, 1990. PMID: 2302686. DOI: 10.1016/0165-4608(90)90067-k
    OpenUrlCrossRefPubMed
    1. Vanni R,
    2. Dal Cin P and
    3. Van Den Berghe H
    : Is the chromosome band 1p36 another hot-spot for rearrangements in uterine leiomyoma? Genes Chromosomes Cancer 2(3): 255–256, 1990. PMID: 2078518. DOI: 10.1002/gcc.2870020316
    OpenUrlCrossRefPubMed
    1. Kiechle-Schwarz M,
    2. Sreekantaiah C,
    3. Berger CS,
    4. Pedron S,
    5. Medchill MT,
    6. Surti U and
    7. Sandberg AA
    : Nonrandom cytogenetic changes in leiomyomas of the female genitourinary tract. A report of 35 cases. Cancer Genet Cytogenet 53(1): 125–136, 1991. PMID: 2036633. DOI: 10.1016/0165-4608(91)90124-d
    OpenUrlCrossRefPubMed
  15. ↵
    1. Pandis N,
    2. Heim S,
    3. Bardi G,
    4. Flodérus UM,
    5. Willén H,
    6. Mandahl N and
    7. Mitelman F
    : Chromosome analysis of 96 uterine leiomyomas. Cancer Genet Cytogenet 55(1): 11–18, 1991. PMID: 1913597. DOI: 10.1016/0165-4608(91)90229-n
    OpenUrlCrossRefPubMed
  16. ↵
    1. Rein MS,
    2. Friedman AJ,
    3. Barbieri RL,
    4. Pavelka K,
    5. Fletcher JA and
    6. Morton CC
    : Cytogenetic abnormalities in uterine leiomyomata. Obstet Gynecol 77(6): 923–926, 1991. PMID: 2030869
    OpenUrlPubMed
    1. Vanni R,
    2. Lecca U and
    3. Faa G
    : Uterine leiomyoma cytogenetics. II. Report of forty cases. Cancer Genet Cytogenet 53(2): 247–256, 1991. PMID: 2065298. DOI: 10.1016/0165-4608(91)90101-y
    OpenUrlCrossRefPubMed
    1. Meloni AM,
    2. Surti U,
    3. Contento AM,
    4. Davare J and
    5. Sandberg AA
    : Uterine leiomyomas: cytogenetic and histologic profile. Obstet Gynecol 80(2): 209–217, 1992. PMID: 1635734.
    OpenUrlPubMed
    1. Stern C,
    2. Deichert U,
    3. Thode B,
    4. Bartnitzke S and
    5. Bullerdiek J
    : Cytogenetic subtyping of 139 uterine leiomyoma. Geburtshilfe Frauenheilkd 52(12): 767–772, 1992. PMID: 1490556. DOI: 10.1055/s-2007-1023809
    OpenUrlCrossRefPubMed
    1. Ozisik YY,
    2. Meloni AM,
    3. Surti U and
    4. Sandberg AA
    : Involvement of 10q22 in leiomyoma. Cancer Genet Cytogenet 69(2): 132–135, 1993. PMID: 8402551. DOI: 10.1016/0165-4608(93)90089-5
    OpenUrlCrossRefPubMed
  21. ↵
    1. Dal Cin P,
    2. Moerman P,
    3. Deprest J,
    4. Brosens I and
    5. Van den Berghe H
    : A new cytogenetic subgroup in uterine leiomyoma is characterized by a deletion of the long arm of chromosome 3. Genes Chromosomes Cancer 13(3): 219–220, 1995. PMID: 7669743. DOI: 10.1002/gcc.2870130313
    OpenUrlCrossRefPubMed
  22. ↵
    1. Xing YP,
    2. Powell WL and
    3. Morton CC
    : The del(7q) subgroup in uterine leiomyomata: genetic and biologic characteristics. Further evidence for the secondary nature of cytogenetic abnormalities in the pathobiology of uterine leiomyomata. Cancer Genet Cytogenet 98(1): 69–74, 1997. PMID: 9309121. DOI: 10.1016/s0165-4608(96)00406-2
    OpenUrlCrossRefPubMed
    1. Rein MS,
    2. Powell WL,
    3. Walters FC,
    4. Weremowicz S,
    5. Cantor RM,
    6. Barbieri RL and
    7. Morton CC
    : Cytogenetic abnormalities in uterine myomas are associated with myoma size. Mol Hum Reprod 4(1): 83–86, 1998. PMID: 9510016. DOI: 10.1093/molehr/4.1.83
    OpenUrlCrossRefPubMed
    1. Kataoka S,
    2. Yamada H,
    3. Hoshi N,
    4. Kudo M,
    5. Hareyama H,
    6. Sakuragi N and
    7. Fujimoto S
    : Cytogenetic analysis of uterine leiomyoma: the size, histopathology and GnRHa-response in relation to chromosome karyotype. Eur J Obstet Gynecol Reprod Biol 110(1): 58–62, 2003. PMID: 12932873. DOI: 10.1016/s0301-2115(03)00075-7
    OpenUrlCrossRefPubMed
    1. Moore SD,
    2. Herrick SR,
    3. Ince TA,
    4. Kleinman MS,
    5. Dal Cin P,
    6. Morton CC and
    7. Quade BJ
    : Uterine leiomyomata with t(10;17) disrupt the histone acetyltransferase MORF. Cancer Res 64(16): 5570–5577, 2004. PMID: 15313893. DOI: 10.1158/0008-5472.CAN-04-0050
    OpenUrlAbstract/FREE Full Text
    1. Nezhad MH,
    2. Drieschner N,
    3. Helms S,
    4. Meyer A,
    5. Tadayyon M,
    6. Klemke M,
    7. Belge G,
    8. Bartnitzke S,
    9. Burchardt K,
    10. Frantzen C,
    11. Schmidt EH and
    12. Bullerdiek J
    : 6p21 rearrangements in uterine leiomyomas targeting HMGA1. Cancer Genet Cytogenet 203(2): 247–252, 2010. PMID: 21156240. DOI: 10.1016/j.cancergencyto.2010.08.005
    OpenUrlCrossRefPubMed
  27. ↵
    1. Hayden MA,
    2. Ordulu Z,
    3. Gallagher CS,
    4. Quade BJ,
    5. Anchan RM,
    6. Middleton NR,
    7. Srouji SS,
    8. Stewart EA and
    9. Morton CC
    : Clinical, pathologic, cytogenetic, and molecular profiling in self-identified black women with uterine leiomyomata. Cancer Genet 222-223: 1–8, 2018. PMID: 29666002. DOI: 10.1016/j.cancergen.2018.01.001
    OpenUrlCrossRefPubMed
  28. ↵
    1. Ozisik YY,
    2. Meloni AM,
    3. Surti U and
    4. Sandberg AA
    : Deletion 7q22 in uterine leiomyoma. A cytogenetic review. Cancer Genet Cytogenet 71(1): 1–6, 1993. PMID: 8275445. DOI: 10.1016/0165-4608(93)90195-r
    OpenUrlCrossRefPubMed
  29. ↵
    1. Rooney DE
    1. Mandahl N
    : Methods in solid tumour cytogenetics. In: Human cytogenetics: malignancy and acquired abnormalities. Rooney DE (ed.). New York, Oxford University Press, pp. 165–203, 2001.
  30. ↵
    1. McGowan-Jordan J,
    2. Simons A and
    3. Schmid M
    : ISCN 2016: An International System for Human Cytogenetic Nomenclature. Basel, Karger, pp. 140, 2016.
  31. ↵
    1. Kangaspeska S,
    2. Hultsch S,
    3. Edgren H,
    4. Nicorici D,
    5. Murumägi A and
    6. Kallioniemi O
    : Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms. PLoS One 7(10): e48745, 2012. PMID: 23119097. DOI: 10.1371/journal.pone.0048745
    OpenUrlCrossRefPubMed
  32. ↵
    1. Nicorici D,
    2. Satalan H,
    3. Edgren H,
    4. Kangaspeska S,
    5. Murumagi A,
    6. Kallioniemi O,
    7. Virtanen S and
    8. Kikku O
    : FusionCatcher - a tool for finding somatic fusion genes in paired-end RNA-sequencing data. bioRxiv, 2014. DOI: 10.1101/011650
    OpenUrlAbstract/FREE Full Text
  33. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Andersen K,
    4. Lund-Iversen M,
    5. Lobmaier I,
    6. Micci F and
    7. Heim S
    : NDRG1-PLAG1 and TRPS1-PLAG1 fusion genes in chondroid syringoma. Cancer Genomics Proteomics 17(3): 237–248, 2020. PMID: 32345665. DOI: 10.21873/cgp.20184
    OpenUrlAbstract/FREE Full Text
  34. ↵
    1. Altschul SF,
    2. Gish W,
    3. Miller W,
    4. Myers EW and
    5. Lipman DJ
    : Basic local alignment search tool. J Mol Biol 215(3): 403–410, 1990. PMID: 2231712. DOI: 10.1016/S0022-2836(05)80360-2
    OpenUrlCrossRefPubMed
  35. ↵
    1. Kent WJ
    : BLAT—the BLAST-like alignment tool. Genome Res 12(4): 656–664, 2002. PMID: 11932250. DOI: 10.1101/gr.229202
    OpenUrlAbstract/FREE Full Text
  36. ↵
    1. Kent WJ,
    2. Sugnet CW,
    3. Furey TS,
    4. Roskin KM,
    5. Pringle TH,
    6. Zahler AM and
    7. Haussler D
    : The human genome browser at UCSC. Genome Res 12(6): 996–1006, 2002. PMID: 12045153. DOI: 10.1101/gr.229102
    OpenUrlAbstract/FREE Full Text
  37. ↵
    1. Roohi J,
    2. Cammer M,
    3. Montagna C and
    4. Hatchwell E
    : An improved method for generating BAC DNA suitable for FISH. Cytogenet Genome Res 121(1): 7–9, 2008. PMID: 18544919. DOI: 10.1159/000124374
    OpenUrlCrossRefPubMed
  38. ↵
    1. Panagopoulos I,
    2. Bjerkehagen B,
    3. Gorunova L,
    4. Taksdal I and
    5. Heim S
    : Rearrangement of chromosome bands 12q14~15 causing HMGA2-SOX5 gene fusion and HMGA2 expression in extraskeletal osteochondroma. Oncol Rep 34(2): 577–584, 2015. PMID: 26043835. DOI: 10.3892/or.2015.4035
    OpenUrlCrossRefPubMed
  39. ↵
    1. Panagopoulos I and
    2. Heim S
    : Interstitial deletions generating fusion genes. Cancer Genomics Proteomics 18(3): 167–196, 2021. PMID: 33893073. DOI: 10.21873/cgp.20251
    OpenUrlAbstract/FREE Full Text
  40. ↵
    1. Mitelman F,
    2. Johansson B and
    3. Mertens F
    : Mitelman database of chromosome aberrations and gene fusions in Cancer. 2022. Available at: https://mitelmandatabase.isb-cgc.org/ [Last accessed on June 6, 2022]
  41. ↵
    1. Ozisik YY,
    2. Meloni AM,
    3. Powell M,
    4. Surti U and
    5. Sandberg AA
    : Chromosome 7 biclonality in uterine leiomyoma. Cancer Genet Cytogenet 67(1): 59–64, 1993. PMID: 8504401. DOI: 10.1016/0165-4608(93)90045-n
    OpenUrlCrossRefPubMed
  42. ↵
    1. Christacos NC,
    2. Quade BJ,
    3. Dal Cin P and
    4. Morton CC
    : Uterine leiomyomata with deletions of Ip represent a distinct cytogenetic subgroup associated with unusual histologic features. Genes Chromosomes Cancer 45(3): 304–312, 2006. PMID: 16320247. DOI: 10.1002/gcc.20291
    OpenUrlCrossRefPubMed
  43. ↵
    1. Liu H,
    2. Du S,
    3. Lei T,
    4. Wang H,
    5. He X,
    6. Tong R and
    7. Wang Y
    : Multifaceted regulation and functions of YAP/TAZ in tumors (Review). Oncol Rep 40(1): 16–28, 2018. PMID: 29749524. DOI: 10.3892/or.2018.6423
    OpenUrlCrossRefPubMed
  44. ↵
    1. Cunningham R and
    2. Hansen CG
    : The Hippo pathway in cancer: YAP/TAZ and TEAD as therapeutic targets in cancer. Clin Sci (Lond) 136(3): 197–222, 2022. PMID: 35119068. DOI: 10.1042/CS20201474
    OpenUrlCrossRefPubMed
  45. ↵
    1. Kanai F,
    2. Marignani PA,
    3. Sarbassova D,
    4. Yagi R,
    5. Hall RA,
    6. Donowitz M,
    7. Hisaminato A,
    8. Fujiwara T,
    9. Ito Y,
    10. Cantley LC and
    11. Yaffe MB
    : TAZ: a novel transcriptional co-activator regulated by interactions with 14-3-3 and PDZ domain proteins. EMBO J 19(24): 6778–6791, 2000. PMID: 11118213. DOI: 10.1093/emboj/19.24.6778
    OpenUrlAbstract/FREE Full Text
    1. Chan SW,
    2. Lim CJ,
    3. Loo LS,
    4. Chong YF,
    5. Huang C and
    6. Hong W
    : TEADs mediate nuclear retention of TAZ to promote oncogenic transformation. J Biol Chem 284(21): 14347–14358, 2009. PMID: 19324876. DOI: 10.1074/jbc.M901568200
    OpenUrlAbstract/FREE Full Text
  47. ↵
    1. Liu C,
    2. Huang W and
    3. Lei Q
    : Regulation and function of the TAZ transcription co-activator. Int J Biochem Mol Biol 2(3): 247–256, 2011. PMID: 22003437.
    OpenUrlPubMed
  48. ↵
    1. Errani C,
    2. Zhang L,
    3. Sung YS,
    4. Hajdu M,
    5. Singer S,
    6. Maki RG,
    7. Healey JH and
    8. Antonescu CR
    : A novel WWTR1-CAMTA1 gene fusion is a consistent abnormality in epithelioid hemangioendothelioma of different anatomic sites. Genes Chromosomes Cancer 50(8): 644–653, 2011. PMID: 21584898. DOI: 10.1002/gcc.20886
    OpenUrlCrossRefPubMed
    1. Tanas MR,
    2. Sboner A,
    3. Oliveira AM,
    4. Erickson-Johnson MR,
    5. Hespelt J,
    6. Hanwright PJ,
    7. Flanagan J,
    8. Luo Y,
    9. Fenwick K,
    10. Natrajan R,
    11. Mitsopoulos C,
    12. Zvelebil M,
    13. Hoch BL,
    14. Weiss SW,
    15. Debiec-Rychter M,
    16. Sciot R,
    17. West RB,
    18. Lazar AJ,
    19. Ashworth A,
    20. Reis-Filho JS,
    21. Lord CJ,
    22. Gerstein MB,
    23. Rubin MA and
    24. Rubin BP
    : Identification of a disease-defining gene fusion in epithelioid hemangioendothelioma. Sci Transl Med 3(98): 98ra82, 2011. PMID: 21885404. DOI: 10.1126/scitranslmed.3002409
    OpenUrlAbstract/FREE Full Text
  50. ↵
    1. Antonescu CR,
    2. Chen HW,
    3. Zhang L,
    4. Sung YS,
    5. Panicek D,
    6. Agaram NP,
    7. Dickson BC,
    8. Krausz T and
    9. Fletcher CD
    : ZFP36-FOSB fusion defines a subset of epithelioid hemangioma with atypical features. Genes Chromosomes Cancer 53(11): 951–959, 2014. PMID: 25043949. DOI: 10.1002/gcc.22206
    OpenUrlCrossRefPubMed
  51. ↵
    1. Tsuda Y,
    2. Suurmeijer AJH,
    3. Sung YS,
    4. Zhang L,
    5. Healey JH and
    6. Antonescu CR
    : Epithelioid hemangioma of bone harboring FOS and FOSB gene rearrangements: A clinicopathologic and molecular study. Genes Chromosomes Cancer 60(1): 17–25, 2021. PMID: 33034932. DOI: 10.1002/gcc.22898
    OpenUrlCrossRefPubMed
  52. ↵
    1. Panagopoulos I,
    2. Lobmaier I,
    3. Gorunova L and
    4. Heim S
    : Fusion of the Genes WWTR1 and FOSB in Pseudomyogenic Hemangioendothelioma. Cancer Genomics Proteomics 16(4): 293–298, 2019. PMID: 31243110. DOI: 10.21873/cgp.20134
    OpenUrlAbstract/FREE Full Text
  53. ↵
    1. Sekine S,
    2. Kiyono T,
    3. Ryo E,
    4. Ogawa R,
    5. Wakai S,
    6. Ichikawa H,
    7. Suzuki K,
    8. Arai S,
    9. Tsuta K,
    10. Ishida M,
    11. Sasajima Y,
    12. Goshima N,
    13. Yamazaki N and
    14. Mori T
    : Recurrent YAP1-MAML2 and YAP1-NUTM1 fusions in poroma and porocarcinoma. J Clin Invest 129(9): 3827–3832, 2019. PMID: 31145701. DOI: 10.1172/JCI126185
    OpenUrlCrossRefPubMed
  54. ↵
    1. Dashti NK,
    2. Dermawan JK,
    3. Schoolmeester JK,
    4. Halling KC and
    5. Antonescu CR
    : A novel WWTR1::AFF2 fusion in an intra-abdominal soft tissue sarcoma with associated endometriosis. Genes Chromosomes Cancer 61(8): 497–502, 2022. PMID: 35429182. DOI: 10.1002/gcc.23045
    OpenUrlCrossRefPubMed
  55. ↵
    1. Basta P,
    2. Strickland MB,
    3. Holmes W,
    4. Loomis CR,
    5. Ballas LM and
    6. Burns DJ
    : Sequence and expression of human protein kinase C-epsilon. Biochim Biophys Acta 1132(2): 154–160, 1992. PMID: 1382605. DOI: 10.1016/0167-4781(92)90006-l
    OpenUrlCrossRefPubMed
  56. ↵
    1. Akita Y
    : Protein kinase C-epsilon (PKC-epsilon): its unique structure and function. J Biochem 132(6): 847–852, 2002. PMID: 12473185. DOI: 10.1093/oxfordjournals.jbchem.a003296
    OpenUrlCrossRefPubMed
  57. ↵
    1. Scruggs SB,
    2. Wang D and
    3. Ping P
    : PRKCE gene encoding protein kinase C-epsilon-Dual roles at sarcomeres and mitochondria in cardiomyocytes. Gene 590(1): 90–96, 2016. PMID: 27312950. DOI: 10.1016/j.gene.2016.06.016
    OpenUrlCrossRefPubMed
  58. ↵
    1. Basu A and
    2. Sivaprasad U
    : Protein kinase Cepsilon makes the life and death decision. Cell Signal 19(8): 1633–1642, 2007. PMID: 17537614. DOI: 10.1016/j.cellsig.2007.04.008
    OpenUrlCrossRefPubMed
  59. ↵
    1. Gorin MA and
    2. Pan Q
    : Protein kinase C epsilon: an oncogene and emerging tumor biomarker. Mol Cancer 8: 9, 2009. PMID: 19228372. DOI: 10.1186/1476-4598-8-9
    OpenUrlCrossRefPubMed
  60. ↵
    1. Ochoa WF,
    2. Garcia-Garcia J,
    3. Fita I,
    4. Corbalan-Garcia S,
    5. Verdaguer N and
    6. Gomez-Fernandez JC
    : Structure of the C2 domain from novel protein kinase Cepsilon. A membrane binding model for Ca(2+)-independent C2 domains. J Mol Biol 311(4): 837–849, 2001. PMID: 11518534. DOI: 10.1006/jmbi.2001.4910
    OpenUrlCrossRefPubMed
  61. ↵
    1. Stahelin RV,
    2. Digman MA,
    3. Medkova M,
    4. Ananthanarayanan B,
    5. Melowic HR,
    6. Rafter JD and
    7. Cho W
    : Diacylglycerol-induced membrane targeting and activation of protein kinase Cepsilon: mechanistic differences between protein kinases Cdelta and Cepsilon. J Biol Chem 280(20): 19784–19793, 2005. PMID: 15769752. DOI: 10.1074/jbc.M411285200
    OpenUrlAbstract/FREE Full Text
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
A Novel Cryptic t(2;3)(p21;q25) Translocation Fuses the WWTR1 and PRKCE Genes in Uterine Leiomyoma With 3q- as the Sole Visible Chromosome Abnormality
IOANNIS PANAGOPOULOS, KRISTIN ANDERSEN, LUDMILA GORUNOVA, BEN DAVIDSON, FRANCESCA MICCI, SVERRE HEIM
Cancer Genomics & Proteomics Sep 2022, 19 (5) 636-646; DOI: 10.21873/cgp.20348
Twitter logo Facebook logo Mendeley logo

Jump to section

Keywords