Research ArticleExperimental Studies
Open Access

Recurrent Fusion of the GRB2 Associated Binding Protein 1 (GAB1) Gene With ABL Proto-oncogene 1 (ABL1) in Benign Pediatric Soft Tissue Tumors

IOANNIS PANAGOPOULOS, LUDMILA GORUNOVA, KRISTIN ANDERSEN, SVETLANA TAFJORD, MARIUS LUND-IVERSEN, INGVILD LOBMAIER, FRANCESCA MICCI and SVERRE HEIM
Cancer Genomics & Proteomics September 2020, 17 (5) 499-508; DOI: https://doi.org/10.21873/cgp.20206

Abstract

Background/Aim: Fusions of the ABL proto-oncogene 1 gene (ABL1 in 9q34) are common in leukemias but rare in solid tumors. The most notable is the t(9;22)(q34;q11)/BCR-ABL1 coding for a chimeric tyrosine kinase. We herein report an ABL1-fusion in a pediatric tumor. Materials and Methods: G-banding, fluorescence in situ hybridization, reverse transcription polymerase chain reaction and Sanger sequencing were performed on a soft tissue perineurioma found in the left musculus erector spinae of a child. Results: A der(4)t(4;9)(q31;q34) and a fusion of the GRB2 associated binding protein 1 (GAB1 in 4q31) gene with ABL1 were found. A literature search revealed 3 more cases with similar genetic and clinicopathological characteristics: a soft tissue perineurioma with t(2;9;4)(p23;q34;q31) and ABL1 rearrangement, a soft tissue angiofibroma with a GAB1-ABL1 chimeric gene, and a solitary fibrous tumor carrying a der(4)t(4;9)(q31.1;q34). Conclusion: GAB1-ABL1 is a recurrent fusion gene in benign pediatric tumors.

The ABL proto-oncogene 1 gene (ABL1, previous symbol ABL) in chromosome band 9q34 is ubiquitously expressed and codes for a non-receptor tyrosine kinase which is localized at many subcellular sites including the nucleus, cytoplasm, mitochondria, and endoplasmic reticulum. It is involved in a variety of cellular processes such as cell division, adhesion, differentiation, and response to stress (1-3). ABL1 together with ABL2 (the proto-oncogene 2 gene which encodes a non-receptor tyrosine kinase and maps to chromosome band 1q25) constitute the ABL family of kinase genes (2, 4-6). Both ABL1 and ABL2 fuse with a variety of translocation partner genes in various hematological malignancies (7-10). The most notable fusion is between ABL1 and the 5’ end of the breakpoint cluster region gene (BCR), located in 22q11, through the t(9;22)(q34;q11) chromosome translocation that gives rise to the Philadelphia chromosome in chronic myeloid leukemia (CML) (11, 12). The BCR-ABL1 fusion gene codes for a leukemogenic, constitutively active tyrosine kinase (11, 12). The discovery that 2-phenylaminopyrimidines inhibit the ABL protein kinase both in vitro and in vivo, led to the development of imatinib mesylate that now constitutes the first-line treatment of CML, as well as to introduction of other protein kinase inhibitors into cancer therapy (13-19).

Rearrangements of the ABL1 and ABL2 genes in solid tumors have also been documented (3-6, 20). Phosphorylation and activation of ABL kinases were reported in various tumors such as breast and lung adenocarcinomas, melanomas, and cancers of the brain (3-6, 20). The mechanisms for activation of ABL1 and ABL2 kinases are in these settings not chromosome translocations/fusion genes but rather genomic amplification, increased expression of mRNA, enhanced protein expression, and increased catalytic activity (3-6, 20).

Perineurioma is a tumor composed entirely of neoplastic perineurial cells with ultrastructural and immunohistochemical features similar to those of their normal counterparts (21). According to the latest WHO Tumors of Soft Tissue and Bones, perineuriomas are nearly always benign, although rare malignant variants have been reported (22). There are two main types: intraneural perineuriomas are confined within peripheral nerve boundaries whereas extraneural perineuriomas are found in soft tissue and skin (21, 23-25). Based on clinicopathological characteristics, the extraneural tumors are further subdivided into soft tissue, sclerosing, and reticular lesions (21, 23, 26-33).

Figure 1.
Figure 1.

Hematoxylin and eosin (H&E) staining of a pediatric soft tissue perineurioma. A) H&E stained section showing well demarcated, unencapsulated, highly cellular solid tumor tissue, magnification 1×. B) H&E stained section (low magnification) showing ovoid to spindle cells, magnification 4×. C) H&E-stained section showing a whorled to storiform growth pattern, magnification 10×. D) H&E-stained section showing relatively uniform cells with oval-shaped to slender, tapering nuclei, magnification 20×.

In the present study, we report the finding of fusion of the GRB2 associated binding protein 1 (GAB1) gene with ABL1 in a pediatric soft tissue perineurioma. We review the literature and conclude that GAB1-ABL1 is a recurrent fusion which appears to characterize a benign, pediatric tumor type.

Materials and Methods

Ethics statement. The study was approved by the Regional Ethics Committee (Regional komité for medisinsk forskningsetikk Sør-Øst, Norge, http://helseforskning.etikkom.no; 2010/1389/REK sør-øst A). Written informed consent was obtained from the patient's parents. The Ethics Committee's approval included a review of the consent procedure. All patient information has been de-identified.

Case description. The patient was a 12-year-old boy with a tumor in the left erector spinae musculature. It measured 65×45×20 mm, was circumscribed but unencapsulated, and showed small areas of infiltration into the skeletal muscle. Microscopically, a whorled to storiform growth pattern was seen (Figure 1). The tumor cells were relatively uniform with oval, slender, relatively uniform nuclei. The cytoplasm showed elongated extensions within a collagenous stroma. Mitotic figures were rarely seen. Immunohistochemistry performed at the primary lab showed negative results for epithelial membrane antigen (EMA), S100 protein, mucin 4 (MUC4), and cluster of differentiation 34 (CD34). After consulting Professor Jason Hornick, Department of Pathology, Brigham and Women's Hospital, Boston, USA, the patient was diagnosed as having a soft tissue perineurioma. Repeated EMA immunohistochemistry at Brigham & Women's Hospital was focally positive.

G-Banding, karyotyping, and fluorescence in situ hybridization (FISH). Cells from a representative area of the tumor were short-term cultured and analyzed cytogenetically as previously described (34). The karyotype was written according to the International System for Human Cytogenomic Nomenclature (35). FISH experiments were performed on interphase nuclei using the ZytoLight SPEC ABL1 Dual Color Break Apart Probe (ZytoVision, Bremerhaven, Germany) following the company's recommendations.

Figure 2.
Figure 2.

Cytogenetic analysis of a pediatric soft tissue perineurioma. A karyogram showing the abnormal chromosomes der(1)(4qter->4q31::9q34->9q34::1p34~35->1qter), der(4)t(4;9)(q31;q34), and der(9)t(1;9)(p34~35;q34). Breakpoint positions are indicated by arrows. tas(17;19)(qter;qter) is not clonal.

Reverse transcription (RT) polymerase chain reaction (PCR) and Sanger sequencing. Total RNA was extracted from frozen (-80°C) tumor tissue adjacent to that used for cytogenetic analysis and histological examination using miRNeasy Mini Kit (Qiagen, Hilden, Germany). For cDNA synthesis, the iScript Advanced cDNA Synthesis Kit for RT-qPCR was used to reverse transcribe one μg of total RNA according to the manufacturer's instructions (Bio-Rad, Hercules, CA, USA). cDNA corresponding to 20 ng total RNA was used as template in subsequent PCR assays. The BigDye Direct Cycle Sequencing Kit was used for PCR/cycle (Sanger) sequencing according to the company's recommendations (ThermoFisher Scientific, Waltham, MA, USA). The primers were M13For-GAB1-1676F1: TGTAAAACGACGGCCAGTCCACCACGACAACATTCCAGCAGTT and M13Rev-ABL1-167R1: CAGGAAACAGCTATGACCGGTCATTTTCACTGGGTCCAGCGA. Sequencing was run on the Applied Biosystems SeqStudio Genetic Analyzer system (ThermoFisher Scientific). For computer analysis of sequence data, the basic local alignment search tool (BLAST) software (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used (36). The web version of Open Reading Frame Finder at NCBI (https://www.ncbi.nlm.nih.gov/orffinder/) was used to search for open reading frames of the sequence.

Results

The initial G-banding analysis yielded a karyotype with a three-way chromosomal translocation as the only cytogenetic aberration: 46,XY,t(1;9;4)(p34~35;q34;q31)[7]/46,XY[4] (Figure 2). FISH with the ZytoLight SPEC ABL1 Dual Color Break Apart Probe showed the following signal pattern in 92 out of 246 (37%) examined interphase nuclei: one red/green (corresponding to normal ABL1), one red (distal part of the probe), and two green signals (proximal part of the probe) (Figure 3A). The results indicated rearrangements of both ABL1 and the region immediately proximal to this gene which hybridized to the 710 Kbp green-labelled part of the probe (Figure 3B). Taking into consideration the initial karyotype as well as the FISH results, we concluded that the observed rearrangement was more complex than it appeared and included at least one cryptic change. A likely explanation is that two cytogenetic events had taken place (Figure 3C): a translocation between chromosomes 4 and 9 which generated a der(4)t(4;9)(q31;q34) and a der(9)t(4;9) (q31;q34), and a translocation between chromosomes 1 (p34~35) and the der(9)t(4;9)(q31;q34). The breakpoint on the der(9) occurred just upstream (proximal) of the ABL1 gene (Figure 3B and C). Thus, part of 9q34 together with 4q31-qter material is translocated to the der(1). Further, the segment from 1pter to 1p34~35 is translocated onto 9q34 from the der(9)t(4;9)(q31;q34) (Figure 3C) which is why we observed two green signals by interphase FISH; a part of the “green” region of the probe hybridized to der(1) whereas the other part hybridized to der(9) (Figure 3C). If we therefore reassess the G-banding karyotype in light of the FISH data, we arrive at the following karyotype: 46,XY,der(1)(4qter->4q31::9q34->9q34::1p34~35->1qter),der(4)t(4;9) (q31;q34),der(9)t(1;9)(p34~35;q34)[7]/46,XY[4].

Figure 3.
Figure 3.

FISH analyses of a pediatric soft tissue perineurioma. A) FISH with the ABL1 break apart probe on a normal nucleus and a nucleus with aberrant hybridization pattern suggesting rearrangements of both ABL1 and the region proximal to ABL1. B) A diagram of the ZytoLight ABL1 break apart probe. Vertical arrows indicate the rearranged regions. C) Diagram showing two hypothetical cytogenetic events that would explain the observed FISH results: Left, translocation between chromosomes 4 and 9 generating the derivative chromosomes der(4)t(4;9)(q31;q34) and der(9)t(4;9)(q31;q34); right, translocation between chromosomes 1 (p34~35) and der(9)t(4;9)(q31;q34) which gives rise to der(1)(4qter->4q31::9q34->9q34::1p34~35->1qter) and der(9)t(1;9)(p34~35;q34). The chromosomes are not in scale.

PCR/cycle (Sanger) sequencing with the primer combination M13For-GAB1-1676F1 and M13Rev-ABL1-167R1 revealed a fusion of GAB1 exon 6 (nucleotide 1898 in the reference sequence NM_002039.4) with ABL1 exon 2 (nucleotide 83 in the reference sequence NM_005157.4) (Figure 4A). Based on the fusion point detected and the reference sequences NM_002039.4 and NM_005157.4, the GAB1-ABL1 fusion transcript is in frame and coding for a 1632 amino acid residues (aa) protein in which the first 528 aa come from GAB1 while the other 1104 aa are from ABL1 (Figure 4B).

Figure 4.
Figure 4.

Results of Sanger sequencing. A) Partial sequence chromatogram of the cDNA amplified fragment showing the junction position of the GAB1 and ABL1 genes (arrow). The exon numbers were based on the sequences with accession numbers NM_002039.4 for GAB1 and NM_005157.4 for ABL1. B) The putative 1632 amino acid residues GAB1-ABL1 protein based on the sequences with accession number NP_002030.2 for GAB1 and NP_005148.2 for ABL1. The pleckstrin homology (PH) domain of GAB1 is in green. The catalytic domain of the protein tyrosine kinase of ABL1 is in yellow. The GAB1-ABL1 junction is in box.

Discussion

We herein present a soft tissue perineurioma with a der(4)t(4;9)(q31;q34) which gave rise to a GAB1-ABL1 fusion gene. A search of the literature revealed 3 additional cases with similar genetic and clinicopathologic characteristics (Table I, cases 9, 11, and 12).

View this table:
Table I.

Clinicopathological data on published intraneural, sclerosing, and soft tissue perineuriomas with abnormal karyotypes. The solitary fibrous tumor with der(4)t(4;9)(q31.1;q34) and the soft tissue angiofibroma with GAB1-ABL1 and associated (assumed) t(4;9) are included.

The first tumor was found in the right shoulder of a 9-year-old girl (Table I, case 11). It was diagnosed as a benign solitary fibrous tumor (SFT). Among various chromosome aberrations, also a der(4)t(4;9)(q31.1;q34) was found (37). SFT may mimic other tumors, among them soft tissue perineurioma (21, 23, 33, 38, 39). However, SFTs are characterized by the pathognomonic NAB2-STAT6 fusion gene resulting from an intrachromosomal inversion involving 12q13.3, which leads to nuclear expression of STAT6 (38-44). Thus, “One should be cautious to call an “SFT-look-alike” tumor an SFT without a positive STAT6 immunostain result” (44).

The second tumor was found in the forearm of a 14-year-old girl (Table I, case 9). It was diagnosed as a soft tissue perineurioma and had a t(2;9;4)(p23;q34;q31) chromosome translocation as the sole cytogenetic aberration (45). Additional experiments with array-comparative genome hybridization and FISH showed that the three-way translocation resulted in interstitial deletions in 2p and 9q as well as rearrangement of ABL1. The 5‘part of ABL1 was deleted whereas the 3‘part was moved to the der(4) (45). The authors concluded that “the translocation between the distal end of the 9q deletion, which is located at 9q34.12, and 4q31 could very likely be significant because 3‘ABL1 is involved” (45). Because the tumor we examined displayed a similar cytogenetic pattern to that of the above-mentioned tumors, i.e., the initial karyotype showed a three-way translocation with breakpoints in chromosome bands 4q31 and 9q34, we performed FISH with an ABL1 break apart probe. This showed splitting of ABL1 (Figure 3A). We considered the possibility that an ABL1-fusion might be located on the der(4), and therefore searched the relevant literature for ABL1 fusions in mesenchymal tumors. This gave information on a third tumor which was located in the foot of a 7-year-old boy, diagnosed as a soft tissue angiofibroma and carrying a GAB1-ABL1 fusion gene (46) (Table I, case 12). However, soft tissue angiofibromas are characterized by the pathognomonic t(5;8)(p15;q13) chromosome translocation or variants thereof resulting in an AHHR-NCOA2 fusion gene (46-50). Moreover, in a case of soft tissue angiofibroma (51), a t(7;8;14)(q11;q13;q31) translocation was found resulting in a GTF2I-NCOA2 fusion. This further emphasizes the role of NCOA2-rearrangements in the development of soft tissue angiofibroma (51). Because there are histologic and immunohistochemical similarities between soft tissue angiofibroma and soft tissue perineurioma (21, 23, 48, 49, 52-55) and because GAB1 maps on chromosome band 4q31, we investigated the present tumor to see if a GAB1-ABL1 fusion gene had been generated. Using RT-PCR/cycle (Sanger) sequencing, we detected an in-frame GAB1-ABL1 fusion transcript with the fusion point identical to the one previously described (46). Because both the GAB1 and ABL1 genes on 4q31 and 9q34, respectively, are transcribed from centromere to telomere, the GAB1-ABL1 fusion gene is predicted to be formed on der(4). Thus, we conclude that the tumor with der(4)t(4;9)(q31.1;q34) (37) and the one with t(2;9;4) (p23;q34;q31) (45) both carried a GAB1-ABL1 fusion gene. In fact, a simple, balanced t(4;9)(q31;q34) chromosome translocation could generate a GAB1-ABL1 fusion.

The GAB1-ABL1 fusion gene would code for a chimeric protein in which the first 28 aa of ABL1 are replaced by the first 528 aa of GAB1. It retains the pleckstrin homology (PH) domain of GAB1 and all the functional domains of ABL1, including the kinase domain (2, 9, 56-58). Thus, GAB1-ABL1 is predicted to be a chimeric tyrosine kinase with similar functions to the chimeric kinases BCR-ABL1, ETV6-ABL1, NUP214-ABL1, ZMIZ1-ABL1, and EML1-ABL1 which were found in hematologic malignancies (9).

Only a limited number of perineuriomas have been studied genetically. Karyotypic data exist on two intraneural tumors, three sclerosing tumors, and, including the present case, five soft tissue perineuriomas (Table I) (45, 59-63). Molecular genetic studies, including FISH, are also very few (28, 60, 64-66).

In intraneural perineurioma, a deletion in chromosome band 22q11 was reported in the first tumor examined whereas structural aberations of 2q11 and 3q12 were seen in the second (59, 61) (Table I, cases 1 and 2). Whole-exome sequencing and copy number variation analysis of another 16 intraneural perineuriomas detected mutation in the TRAF7 gene (which maps on 16p13) in 10 (60%) and larger deletions of chromosomes 10, 11, and 22 in two tumors (65).

In the three reported sclerosing perineuriomas with abnormal karyotypes, alteration of chromosome 10 was seen (60, 61) (Table I, cases 3, 4, and 5). One tumor had two chromosome translocations involving 10q24 (Table I, case 3), a second had loss of chromosomes 10 and 22 (Table I, case 4), and the third had a deletion involving 10q24 and loss of chromosome 10 (Table I, case 5) (60, 61, 67). Molecular studies of sclerosing tumors suggested a tumorigenic role of NF2 (on 22q12.2) abnormalities (60, 64). Lasota et al. (64) found point mutations in NF2 coding sequences in three of five sclerosing perineuriomas while Sciot et al. (60) found a cryptic deletion in NF2, in addition to a deletion involving 10q24, in another sclerosing perineurioma (Table I, case 5).

In soft tissue perineuriomas other than the above-mentioned tumors, three more cases have been reported with abnormal karyotypes (Table 1, cases 6, 7, and 8): a tumor of the thigh in a 26-year-old woman showing loss of chromosome 13 (Table I, case 6), an intrabdominal tumor in a 13-year-old girl with a t(8;9)(q13;q22) as the sole cytogenetic aberration (Table I, case 7), and a tumor of the foot in a 43-year-old man whose tumor cells had an add(2)(q33) and t(4;10)(q25;q24) (Table I, case 8) (61-63). Whole exome sequencing and copy number variation analysis of 14 soft tissue perineuriomas showed deletions of 22q12 encompassing NF2 in 6 tumors, whereas 4 tumors had deletion of 17q11 encompassing NF1. No point mutations were detected in NF1, NF2, or TRAF7 (66).

The existing data, those previously published together with what we describe here, therefore indicate three different pathogenetic pathways in perineuriomas. The first pathway involves rearrangements of chromosome 22/NF2 gene or chromosome 17/NF1 gene, the second involves chromosome band 10q24, whereas the third involves chromosome translocations in which chromosome bands 4q31 and 9q34 are recombined to generate a GAB1-ABL1 fusion gene.

Acknowledgements

The Authors thank Professor Jason Hornick, Department of Pathology, Brigham and Women's Hospital, Boston USA for help with the diagnosis. This work was supported by grants from Radiumhospitalets Legater.

Footnotes

  • Authors' Contributions

    IP designed and supervised the research, performed molecular genetic experiments and bioinformatics analysis, and wrote the article. LG performed cytogenetic analysis and evaluated the FISH data. KA performed molecular genetic experiments, FISH analyses, and evaluated the data. ST performed pathological examination. ML-I performed pathological examination. IL performed pathological examination. FM evaluated the cytogenetic and FISH data. SH assisted with experimental design and writing of the article. All Authors read and approved the final manuscript.

  • This article is freely accessible online.

  • Conflicts of Interest

    The Authors declare that they have no potential conflicts of interest in regard to this study.

  • Received April 21, 2020.
  • Revision received May 22, 2020.
  • Accepted June 1, 2020.

References

  1. ↵
    1. Colicelli J
    : ABL tyrosine kinases: Evolution of function, regulation, and specificity. Sci Signal 3(139): re6, 2010. PMID: 20841568. DOI: 10.1126/scisignal.3139re6
    OpenUrlAbstract/FREE Full Text
  2. ↵
    1. Wang JY
    : The capable ABL: What is its biological function? Mol Cell Biol 34(7): 1188-1197, 2014. PMID: 24421390. DOI: 10.1128/MCB.01454-13
    OpenUrlAbstract/FREE Full Text
  3. ↵
    1. Khatri A,
    2. Wang J,
    3. Pendergast AM
    : Multifunctional ABL kinases in health and disease. J Cell Sci 129(1): 9-16, 2016. PMID: 26729027. DOI: 10.1242/jcs.175521
    OpenUrlAbstract/FREE Full Text
  4. ↵
    1. Greuber EK,
    2. Smith-Pearson P,
    3. Wang J,
    4. Pendergast AM
    : Role of ABL family kinases in cancer: From leukaemia to solid tumours. Nat Rev Cancer 13(8): 559-571, 2013. PMID: 23842646. DOI: 10.1038/nrc3563
    OpenUrlCrossRefPubMed
    1. Wang J,
    2. Pendergast AM
    : The emerging role of ABL kinases in solid tumors. Trends Cancer 1(2): 110-123, 2015. PMID: 26645050. DOI: 10.1016/j.trecan.2015.07.004
    OpenUrl
  6. ↵
    1. Tripathi R,
    2. Liu Z,
    3. Plattner R
    : Enabling tumor growth and progression: Recent progress in unraveling the functions of ABL kinases in solid tumor cells. Curr Pharmacol Rep 4(5): 367-379, 2018. PMID: 30746323. DOI: 10.1007/s40495-018-0149-y
    OpenUrl
  7. ↵
    1. Tasian SK,
    2. Loh ML,
    3. Hunger SP
    : Philadelphia chromosome-like acute lymphoblastic leukemia. Blood 130(19): 2064-2072, 2017. PMID: 28972016. DOI: 10.1182/blood-2017-06-743252
    OpenUrlAbstract/FREE Full Text
    1. Heim S,
    2. Mitelman F
    : Cancer cytogenetics: Chromosomal and molecular genetic abberations of tumor cells. Fourth Edition edn. Wiley-Blackwell, 2015.
  9. ↵
    1. De Braekeleer E,
    2. Douet-Guilbert N,
    3. Rowe D,
    4. Bown N,
    5. Morel F,
    6. Berthou C,
    7. Ferec C,
    8. De Braekeleer M
    : ABL1 fusion genes in hematological malignancies: A review. Eur J Haematol 86(5): 361-371, 2011. PMID: 21435002. DOI: 10.1111/j.1600-0609.2011.01586.x
    OpenUrlCrossRefPubMed
  10. ↵
    1. Hagemeijer A,
    2. Graux C
    : ABL1 rearrangements in t-cell acute lymphoblastic leukemia. Genes Chromosomes Cancer 49(4): 299-308, 2010. PMID: 20073070. DOI: 10.1002/gcc.20743
    OpenUrlCrossRefPubMed
  11. ↵
    1. Mughal TI,
    2. Radich JP,
    3. Deininger MW,
    4. Apperley JF,
    5. Hughes TP,
    6. Harrison CJ,
    7. Gambacorti-Passerini C,
    8. Saglio G,
    9. Cortes J,
    10. Daley GQ
    : Chronic myeloid leukemia: Reminiscences and dreams. Haematologica 101(5): 541-558, 2016. PMID: 27132280. DOI: 10.3324/haematol.2015.139337
    OpenUrlAbstract/FREE Full Text
  12. ↵
    1. Wong S,
    2. Witte ON
    : The BCR-ABL story: Bench to bedside and back. Annu Rev Immunol 22: 247-306, 2004. PMID: 15032571. DOI: 10.1146/annurev.immunol.22.012703.104753
    OpenUrlCrossRefPubMed
  13. ↵
    1. Buchdunger E,
    2. Zimmermann J,
    3. Mett H,
    4. Meyer T,
    5. Muller M,
    6. Druker BJ,
    7. Lydon NB
    : Inhibition of the ABL protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative. Cancer Res 56(1): 100-104, 1996. PMID: 8548747.
    OpenUrlAbstract/FREE Full Text
    1. Druker BJ,
    2. Lydon NB
    : Lessons learned from the development of an ABL tyrosine kinase inhibitor for chronic myelogenous leukemia. J Clin Invest 105(1): 3-7, 2000. PMID: 10619854. DOI: 10.1172/JCI9083
    OpenUrlCrossRefPubMed
    1. Druker BJ,
    2. Sawyers CL,
    3. Kantarjian H,
    4. Resta DJ,
    5. Reese SF,
    6. Ford JM,
    7. Capdeville R,
    8. Talpaz M
    : Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the philadelphia chromosome. N Engl J Med 344(14): 1038-1042, 2001. PMID: 11287973. DOI: 10.1056/NEJM200104053441402
    OpenUrlCrossRefPubMed
    1. Druker BJ,
    2. Talpaz M,
    3. Resta DJ,
    4. Peng B,
    5. Buchdunger E,
    6. Ford JM,
    7. Lydon NB,
    8. Kantarjian H,
    9. Capdeville R,
    10. Ohno-Jones S,
    11. Sawyers CL
    : Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med 344(14): 1031-1037, 2001. PMID: 11287972. DOI: 10.1056/NEJM200104053441401
    OpenUrlCrossRefPubMed
    1. Gross S,
    2. Rahal R,
    3. Stransky N,
    4. Lengauer C,
    5. Hoeflich KP
    : Targeting cancer with kinase inhibitors. J Clin Invest 125(5): 1780-1789, 2015. PMID: 25932675. DOI: 10.1172/JCI76094
    OpenUrlCrossRefPubMed
    1. Ferguson FM,
    2. Gray NS
    : Kinase inhibitors: The road ahead. Nat Rev Drug Discov 17(5): 353-377, 2018. PMID: 29545548. DOI: 10.1038/nrd.2018.21
    OpenUrlCrossRefPubMed
  19. ↵
    1. Kannaiyan R,
    2. Mahadevan D
    : A comprehensive review of protein kinase inhibitors for cancer therapy. Expert Rev Anticancer Ther 18(12): 1249-1270, 2018. PMID: 30259761. DOI: 10.1080/14737140.2018.1527688
    OpenUrl
  20. ↵
    1. Ganguly SS,
    2. Plattner R
    : Activation of ABL family kinases in solid tumors. Genes Cancer 3(5-6): 414-425, 2012. PMID: 23226579. DOI: 10.1177/1947601912458586
    OpenUrlCrossRefPubMed
  21. ↵
    1. Macarenco RS,
    2. Ellinger F,
    3. Oliveira AM
    : Perineurioma: A distinctive and underrecognized peripheral nerve sheath neoplasm. Arch Pathol Lab Med 131(4): 625-636, 2007. PMID: 17425397. DOI: 10.1043/1543-2165(2007)131[625:PADAUP]2.0.CO;2
    OpenUrlPubMed
  22. ↵
    1. Fletcher CDM,
    2. Bridge JA,
    3. Hogendoorn PCW,
    4. Mertens F
    1. Hornick JL,
    2. Fletcher CDM,
    3. Fletcher JA
    : Perineurioma. In: World health organization classification of tumours of soft tissue and bone. Fletcher CDM, Bridge JA, Hogendoorn PCW, Mertens F (eds.). IARC Press: Lyon, pp. 176-178, 2013.
  23. ↵
    1. Hornick JL,
    2. Fletcher CD
    : Soft tissue perineurioma: Clinicopathologic analysis of 81 cases including those with atypical histologic features. Am J Surg Pathol 29(7): 845-858, 2005. PMID: 15958848. DOI: 10.1097/01.pas.0000155166.86409.d2
    OpenUrlCrossRefPubMed
    1. Boyanton BL Jr.,
    2. Jones JK,
    3. Shenaq SM,
    4. Hicks MJ,
    5. Bhattacharjee MB
    : Intraneural perineurioma: A systematic review with illustrative cases. Arch Pathol Lab Med 131(9): 1382-1392, 2007. PMID: 17824794. DOI: 10.1043/1543-2165(2007)131[1382:IPASRW]2.0.CO;2
    OpenUrlPubMed
  25. ↵
    1. Mauermann ML,
    2. Amrami KK,
    3. Kuntz NL,
    4. Spinner RJ,
    5. Dyck PJ,
    6. Bosch EP,
    7. Engelstad J,
    8. Felmlee JP,
    9. Dyck PJ
    : Longitudinal study of intraneural perineurioma—a benign, focal hypertrophic neuropathy of youth. Brain 132(Pt 8): 2265-2276, 2009. PMID: 19567701. DOI: 10.1093/brain/awp169
    OpenUrlCrossRefPubMed
  26. ↵
    1. Tsang WY,
    2. Chan JK,
    3. Chow LT,
    4. Tse CC
    : Perineurioma: An uncommon soft tissue neoplasm distinct from localized hypertrophic neuropathy and neurofibroma. Am J Surg Pathol 16(8): 756-763, 1992. PMID: 1497116. DOI: 10.1097/00000478-199208000-00003
    OpenUrlCrossRefPubMed
    1. Fetsch JF,
    2. Miettinen M
    : Sclerosing perineurioma: A clinicopathologic study of 19 cases of a distinctive soft tissue lesion with a predilection for the fingers and palms of young adults. Am J Surg Pathol 21(12): 1433-1442, 1997. PMID: 9414186. DOI: 10.1097/00000478-199712000-00005
    OpenUrlCrossRefPubMed
  28. ↵
    1. Giannini C,
    2. Scheithauer BW,
    3. Jenkins RB,
    4. Erlandson RA,
    5. Perry A,
    6. Borell TJ,
    7. Hoda RS,
    8. Woodruff JM
    : Soft-tissue perineurioma. Evidence for an abnormality of chromosome 22, criteria for diagnosis, and review of the literature. Am J Surg Pathol 21(2): 164-173, 1997. PMID: 9042282. DOI: 10.1097/00000478-199702000-00005
    OpenUrlCrossRefPubMed
    1. Graadt van Roggen JF,
    2. McMenamin ME,
    3. Belchis DA,
    4. Nielsen GP,
    5. Rosenberg AE,
    6. Fletcher CD
    : Reticular perineurioma: A distinctive variant of soft tissue perineurioma. Am J Surg Pathol 25(4): 485-493, 2001. PMID: 11257623. DOI: 10.1097/00000478-200104000-00008
    OpenUrlCrossRefPubMed
    1. Balarezo FS,
    2. Muller RC,
    3. Weiss RG,
    4. Brown T,
    5. Knibbs D,
    6. Joshi VV
    : Soft tissue perineuriomas in children: Report of three cases and review of the literature [corrected]. Pediatr Dev Pathol 6(2): 137-141, 2003. PMID: 12545405. DOI: 10.1007/s10024-001-0119-x
    OpenUrlCrossRefPubMed
    1. Canales-Ibarra C,
    2. Magarinos G,
    3. Olsoff-Pagovich P,
    4. Ortiz-Hidalgo C
    : Cutaneous sclerosing perineurioma of the digits: An uncommon soft-tissue neoplasm. Report of two cases with immunohistochemical analysis. J Cutan Pathol 30(9): 577-581, 2003. PMID: 14507408. DOI: 10.1034/j.1600-0560.2003.00108.x
    OpenUrlPubMed
    1. Yamaguchi U,
    2. Hasegawa T,
    3. Hirose T,
    4. Fugo K,
    5. Mitsuhashi T,
    6. Shimizu M,
    7. Kawai A,
    8. Ito Y,
    9. Chuman H,
    10. Beppu Y
    : Sclerosing perineurioma: A clinicopathological study of five cases and diagnostic utility of immunohistochemical staining for glut1. Virchows Arch 443(2): 159-163, 2003. PMID: 12836021. DOI: 10.1007/s00428-003-0849-4
    OpenUrlCrossRefPubMed
  33. ↵
    1. Rankine AJ,
    2. Filion PR,
    3. Platten MA,
    4. Spagnolo DV
    : Perineurioma: A clinicopathological study of eight cases. Pathology 36(4): 309-315, 2004. PMID: 15370128. DOI: 10.1080/00313020410001721663
    OpenUrlCrossRefPubMed
  34. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Lund-Iversen M,
    4. Andersen K,
    5. Andersen HK,
    6. Lobmaier I,
    7. Bjerkehagen B,
    8. Heim S
    : Cytogenetics of spindle cell/pleomorphic lipomas: Karyotyping and fish analysis of 31 tumors. Cancer Genomics Proteomics 15(3): 193-200, 2018. PMID: 29695401. DOI: 10.21873/cgp.20077
    OpenUrlAbstract/FREE Full Text
  35. ↵
    1. McGowan-Jordan J,
    2. Simons A,
    3. Schmid M
    : ISCN 2016: An international system for human cytogenomic nomenclature Karger: Basel, pp. 140, 2016.
  36. ↵
    1. Altschul SF,
    2. Gish W,
    3. Miller W,
    4. Myers EW,
    5. Lipman DJ
    : Basic local alignment search tool. J Mol Biol 215(3): 403-410, 1990. PMID: 2231712. DOI: 10.1016/S0022-2836(05)80360-2
    OpenUrlCrossRefPubMed
  37. ↵
    1. Rakheja D,
    2. Wilson KS,
    3. Meehan JJ,
    4. Schultz RA,
    5. Maale GE,
    6. Timmons CF
    : Extrapleural benign solitary fibrous tumor in the shoulder of a 9-year-old girl: Case report and review of the literature. Pediatr Dev Pathol 7(6): 653-660, 2004. PMID: 15630539. DOI: 10.1007/s10024-004-6065-7
    OpenUrlCrossRefPubMed
  38. ↵
    1. Doyle LA,
    2. Vivero M,
    3. Fletcher CD,
    4. Mertens F,
    5. Hornick JL
    : Nuclear expression of STAT6 distinguishes solitary fibrous tumor from histologic mimics. Mod Pathol 27(3): 390-395, 2014. PMID: 24030747. DOI: 10.1038/modpathol.2013.164
    OpenUrlCrossRefPubMed
  39. ↵
    1. Vogels RJ,
    2. Vlenterie M,
    3. Versleijen-Jonkers YM,
    4. Ruijter E,
    5. Bekers EM,
    6. Verdijk MA,
    7. Link MM,
    8. Bonenkamp JJ,
    9. van der Graaf WT,
    10. Slootweg PJ,
    11. Suurmeijer AJ,
    12. Groenen PJ,
    13. Flucke U
    : Solitary fibrous tumor - clinicopathologic, immunohistochemical and molecular analysis of 28 cases. Diagn Pathol 9: 224, 2014. PMID: 25432794. DOI: 10.1186/s13000-014-0224-6
    OpenUrlCrossRefPubMed
    1. Chmielecki J,
    2. Crago AM,
    3. Rosenberg M,
    4. O'Connor R,
    5. Walker SR,
    6. Ambrogio L,
    7. Auclair D,
    8. McKenna A,
    9. Heinrich MC,
    10. Frank DA,
    11. Meyerson M
    : Whole-exome sequencing identifies a recurrent NAB2-STAT6 fusion in solitary fibrous tumors. Nat Genet 45(2): 131-132, 2013. PMID: 23313954. DOI: 10.1038/ng.2522
    OpenUrlCrossRefPubMed
    1. Mohajeri A,
    2. Tayebwa J,
    3. Collin A,
    4. Nilsson J,
    5. Magnusson L,
    6. von Steyern FV,
    7. Brosjo O,
    8. Domanski HA,
    9. Larsson O,
    10. Sciot R,
    11. Debiec-Rychter M,
    12. Hornick JL,
    13. Mandahl N,
    14. Nord KH,
    15. Mertens F
    : Comprehensive genetic analysis identifies a pathognomonic NAB2/STAT6 fusion gene, nonrandom secondary genomic imbalances, and a characteristic gene expression profile in solitary fibrous tumor. Genes Chromosomes Cancer 52(10): 873-886, 2013. PMID: 23761323. DOI: 10.1002/gcc.22083
    OpenUrlCrossRefPubMed
    1. Robinson DR,
    2. Wu YM,
    3. Kalyana-Sundaram S,
    4. Cao X,
    5. Lonigro RJ,
    6. Sung YS,
    7. Chen CL,
    8. Zhang L,
    9. Wang R,
    10. Su F,
    11. Iyer MK,
    12. Roychowdhury S,
    13. Siddiqui J,
    14. Pienta KJ,
    15. Kunju LP,
    16. Talpaz M,
    17. Mosquera JM,
    18. Singer S,
    19. Schuetze SM,
    20. Antonescu CR,
    21. Chinnaiyan AM
    : Identification of recurrent NAB2-STAT6 gene fusions in solitary fibrous tumor by integrative sequencing. Nat Genet 45(2): 180-185, 2013. PMID: 23313952. DOI: 10.1038/ng.2509
    OpenUrlCrossRefPubMed
    1. Demicco EG,
    2. Harms PW,
    3. Patel RM,
    4. Smith SC,
    5. Ingram D,
    6. Torres K,
    7. Carskadon SL,
    8. Camelo-Piragua S,
    9. McHugh JB,
    10. Siddiqui J,
    11. Palanisamy N,
    12. Lucas DR,
    13. Lazar AJ,
    14. Wang WL
    : Extensive survey of STAT6 expression in a large series of mesenchymal tumors. Am J Clin Pathol 143(5): 672-682, 2015. PMID: 25873501. DOI: 10.1309/AJCPN25NJTOUNPNF
    OpenUrlCrossRefPubMed
  44. ↵
    1. Wei S,
    2. Henderson-Jackson E,
    3. Qian X,
    4. Bui MM
    : Soft tissue tumor immunohistochemistry update: Illustrative examples of diagnostic pearls to avoid pitfalls. Arch Pathol Lab Med 141(8): 1072-1091, 2017. PMID: 28745570. DOI: 10.5858/arpa.2016-0417-RA
    OpenUrl
  45. ↵
    1. Duff DJ,
    2. Guzman MA,
    3. Batanian JR
    : ABL1 gene involvement within a complex three-way translocation (2;9;4) in perineurioma characterized by molecular cytogenetic methods. Cancer Genet 207(6): 263-267, 2014. PMID: 25074247. DOI: 10.1016/j.cancergen.2014.05.012
    OpenUrl
  46. ↵
    1. Bekers EM,
    2. Groenen P,
    3. Verdijk MAJ,
    4. Raaijmakers-van Geloof WL,
    5. Roepman P,
    6. Vink R,
    7. Gilhuijs NDB,
    8. van Gorp JM,
    9. Bovee J,
    10. Creytens DH,
    11. Flanagan AM,
    12. Suurmeijer AJH,
    13. Mentzel T,
    14. Arbajian E,
    15. Flucke U
    : Soft tissue angiofibroma: Clinicopathologic, immunohistochemical and molecular analysis of 14 cases. Genes Chromosomes Cancer 56(10): 750-757, 2017. PMID: 28639284. DOI: 10.1002/gcc.22478
    OpenUrl
    1. Jin Y,
    2. Moller E,
    3. Nord KH,
    4. Mandahl N,
    5. Von Steyern FV,
    6. Domanski HA,
    7. Marino-Enriquez A,
    8. Magnusson L,
    9. Nilsson J,
    10. Sciot R,
    11. Fletcher CD,
    12. Debiec-Rychter M,
    13. Mertens F
    : Fusion of the AHRR and NCOA2 genes through a recurrent translocation t(5;8)(p15;q13) in soft tissue angiofibroma results in upregulation of aryl hydrocarbon receptor target genes. Genes Chromosomes Cancer 51(5): 510-520, 2012. PMID: 22337624. DOI: 10.1002/gcc.21939
    OpenUrlCrossRefPubMed
  48. ↵
    1. Marino-Enriquez A,
    2. Fletcher CD
    : Angiofibroma of soft tissue: Clinicopathologic characterization of a distinctive benign fibrovascular neoplasm in a series of 37 cases. Am J Surg Pathol 36(4): 500-508, 2012. PMID: 22301504. DOI: 10.1097/PAS.0b013e31823defbe
    OpenUrlPubMed
  49. ↵
    1. Edgar MA,
    2. Lauer SR,
    3. Bridge JA,
    4. Rizzo M
    : Soft tissue angiofibroma: Report of 2 cases of a recently described tumor. Hum Pathol 44(3): 438-441, 2013. PMID: 23261176. DOI: 10.1016/j.humpath.2012.08.021
    OpenUrl
  50. ↵
    1. Panagopoulos I,
    2. Gorunova L,
    3. Viset T,
    4. Heim S
    : Gene fusions AHRR-NCOA2, NCOA2-ETV4, ETV4-AHRR, P4HA2-TBCK, and TBCK-P4HA2 resulting from the translocations t(5;8;17) (p15;q13;q21) and t(4;5)(q24;q31) in a soft tissue angiofibroma. Oncol Rep 36(5): 2455-2462, 2016. PMID: 27633981. DOI: 10.3892/or.2016.5096
    OpenUrl
  51. ↵
    1. Arbajian E,
    2. Magnusson L,
    3. Mertens F,
    4. Domanski HA,
    5. Vult von Steyern F,
    6. Nord KH
    : A novel GTF2I/NCOA2 fusion gene emphasizes the role of NCOA2 in soft tissue angiofibroma development. Genes Chromosomes Cancer 52(3): 330-331, 2013. PMID: 23225380. DOI: 10.1002/gcc.22033
    OpenUrlCrossRefPubMed
  52. ↵
    1. Zamecnik M,
    2. Mukensnabl P,
    3. Chlumska A
    : Angiofibroma-like perineurioma. Report of a case. Cesk Patol 49(2): 86-88, 2013. PMID: 23641714.
    OpenUrl
    1. Zhao M,
    2. Sun K,
    3. Li C,
    4. Zheng J,
    5. Yu J,
    6. Jin J,
    7. Xia W
    : Angiofibroma of soft tissue: Clinicopathologic study of 2 cases of a recently characterized benign soft tissue tumor. Int J Clin Exp Pathol 6(10): 2208-2215, 2013. PMID: 24133600.
    OpenUrl
    1. Ma HJ,
    2. Huang HN,
    3. Li L,
    4. Chen S,
    5. Zhang RY
    : Clinicopathological characteristics of angiofibroma of soft tissue: Report of three cases. Int J Clin Exp Pathol 11(7): 3777-3784, 2018. PMID: 31949763.
    OpenUrl
  55. ↵
    1. Mindiola-Romero AE,
    2. Maloney N,
    3. Bridge JA,
    4. Korkolopoulou P,
    5. Sakellariou S,
    6. Linos K
    : A concise review of angiofibroma of soft tissue: A rare newly described entity that can be encountered by dermatopathologists. J Cutan Pathol 47(2): 179-185, 2020. PMID: 31568567. DOI: 10.1111/cup.13580
    OpenUrl
  56. ↵
    1. Liu Y,
    2. Rohrschneider LR
    : The gift of gab. FEBS Lett 515(1-3): 1-7, 2002. PMID: 11943184. DOI: 10.1016/s0014-5793(02)02425-0
    OpenUrlCrossRefPubMed
    1. Nishida K,
    2. Hirano T
    : The role of gab family scaffolding adapter proteins in the signal transduction of cytokine and growth factor receptors. Cancer Sci 94(12): 1029-1033, 2003. PMID: 14662016. DOI: 10.1111/j.1349-7006.2003.tb01396.x
    OpenUrlCrossRefPubMed
  58. ↵
    1. Scheffzek K,
    2. Welti S
    : Pleckstrin homology (ph) like domains - versatile modules in protein-protein interaction platforms. FEBS Lett 586(17): 2662-2673, 2012. PMID: 22728242. DOI: 10.1016/j.febslet.2012.06.006
    OpenUrlCrossRefPubMed
  59. ↵
    1. Emory TS,
    2. Scheithauer BW,
    3. Hirose T,
    4. Wood M,
    5. Onofrio BM,
    6. Jenkins RB
    : Intraneural perineurioma. A clonal neoplasm associated with abnormalities of chromosome 22. Am J Clin Pathol 103(6): 696-704, 1995. PMID: 7785653. DOI: 10.1093/ajcp/103.6.696
    OpenUrlCrossRefPubMed
  60. ↵
    1. Sciot R,
    2. Dal Cin P,
    3. Hagemeijer A,
    4. De Smet L,
    5. Van Damme B,
    6. Van den Berghe H
    : Cutaneous sclerosing perineurioma with cryptic NF2 gene deletion. Am J Surg Pathol 23(7): 849-853, 1999. PMID: 10403310. DOI: 10.1097/00000478-199907000-00015
    OpenUrlCrossRefPubMed
  61. ↵
    1. Brock JE,
    2. Perez-Atayde AR,
    3. Kozakewich HP,
    4. Richkind KE,
    5. Fletcher JA,
    6. Vargas SO
    : Cytogenetic aberrations in perineurioma: Variation with subtype. Am J Surg Pathol 29(9): 1164-1169, 2005. PMID: 16096405. DOI: 10.1097/01.pas.0000158397.65190.9f
    OpenUrlPubMed
    1. Mott RT,
    2. Goodman BK,
    3. Burchette JL,
    4. Cummings TJ
    : Loss of chromosome 13 in a case of soft tissue perineurioma. Clin Neuropathol 24(2): 69-76, 2005. PMID: 15803806.
    OpenUrlPubMed
  63. ↵
    1. Nishio J,
    2. Iwasaki H,
    3. Hayashi H,
    4. Nabeshima K,
    5. Naito M
    : Soft tissue perineurioma of the foot with 10q24 rearrangements: Unique MRI features with histopathologic correlation. Skeletal Radiol 43(7): 1017-1022, 2014. PMID: 24562506. DOI: 10.1007/s00256-014-1839-0
    OpenUrl
  64. ↵
    1. Lasota J,
    2. Fetsch JF,
    3. Wozniak A,
    4. Wasag B,
    5. Sciot R,
    6. Miettinen M
    : The neurofibromatosis type 2 gene is mutated in perineurial cell tumors: A molecular genetic study of eight cases. Am J Pathol 158(4): 1223-1229, 2001. PMID: 11290539. DOI: 10.1016/S0002-9440(10)64072-2
    OpenUrlPubMed
  65. ↵
    1. Klein CJ,
    2. Wu Y,
    3. Jentoft ME,
    4. Mer G,
    5. Spinner RJ,
    6. Dyck PJ,
    7. Dyck PJ,
    8. Mauermann ML
    : Genomic analysis reveals frequent TRAF7 mutations in intraneural perineuriomas. Ann Neurol 81(2): 316-321, 2017. PMID: 28019650. DOI: 10.1002/ana.24854
    OpenUrl
  66. ↵
    1. Carter JM,
    2. Wu Y,
    3. Blessing MM,
    4. Folpe AL,
    5. Thorland EC,
    6. Spinner RJ,
    7. Jentoft ME,
    8. Wang C,
    9. Baheti S,
    10. Niu Z,
    11. Mauermann ML,
    12. Klein CJ
    : Recurrent genomic alterations in soft tissue perineuriomas. Am J Surg Pathol 42(12): 1708-1714, 2018. PMID: 30303818. DOI: 10.1097/PAS.0000000000001169
    OpenUrl
  67. ↵
    1. Mertens F,
    2. Dal Cin P,
    3. De Wever I,
    4. Fletcher CD,
    5. Mandahl N,
    6. Mitelman F,
    7. Rosai J,
    8. Rydholm A,
    9. Sciot R,
    10. Tallini G,
    11. van Den Berghe H,
    12. Vanni R,
    13. Willen H
    : Cytogenetic characterization of peripheral nerve sheath tumours: A report of the champ study group. J Pathol 190(1): 31-38, 2000. PMID: 10640989. DOI: 10.1002/(SICI)1096-9896(200001)190:1<31::AID-PATH505>3.0.CO;2-%23
    OpenUrlCrossRefPubMed
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Recurrent Fusion of the GRB2 Associated Binding Protein 1 (GAB1) Gene With ABL Proto-oncogene 1 (ABL1) in Benign Pediatric Soft Tissue Tumors
IOANNIS PANAGOPOULOS, LUDMILA GORUNOVA, KRISTIN ANDERSEN, SVETLANA TAFJORD, MARIUS LUND-IVERSEN, INGVILD LOBMAIER, FRANCESCA MICCI, SVERRE HEIM
Cancer Genomics & Proteomics Sep 2020, 17 (5) 499-508; DOI: 10.21873/cgp.20206
del.icio.us logo Digg logo Reddit logo Twitter logo Facebook logo Google logo Mendeley logo

Jump to section

Keywords