Abstract
Background/Aim: Given the diagnostic, prognostic, biologic, and even therapeutic impact of leukemia-associated translocations and fusion genes, it is important to detect cryptic genomic rearrangements that may exist in hematological malignancies. Case Report: RNA-sequencing was performed on an acute myeloid leukemia case with the bone marrow karyotype 45,X,-Y,t(9;12) (q34;q15)[16]. Results: The DEK-NUP214 and PRRC2B-DEK fusion genes were found. Reverse transcriptase polymerase chain reaction together with direct sequencing verified the presence of both. Fluorescence in situ hybridization showed that the DEK-NUP214 fusion gene was located on the 6p22 band of a seemingly normal chromosome 6. Conclusion: RNA-sequencing proved to be a valuable tool for the detection of a fusion of genes DEK and NUP214 in a leukemia that showed cryptic cytogenetic rearrangement of chromosome band 9q34.
Acquired genetic abnormalities are present in the leukemic bone marrow cells in hematologicαλ malignancies, including acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) (1-4). Microscopic studies have shown that these aberrations are often visible as balanced chromosomal changes such as translocations and inversions, as well as unbalanced anomalies such as deletions, monosomies, duplications, and trisomies (1). Leukemia-associated translocations and inversions often result in fusions at the breakpoints through melting together parts of two genes, one in each breakpoint. The chromosomal rearrangements giving rise to fusion genes are often seen as sole aberrations at cytogenetic analysis, are considered to be primary tumorigenic events, and are of pathogenetic, diagnostic, and prognostic importance (1).
Sometimes, cytogenetic analyses fail to detect chromosomal rearrangements because the regions involved are of similar size and have similar banding patterns, because of poor chromosome morphology and spreading, because too few metaphase cells could be analyzed, or only normal metaphases derived from non-leukemic cells are found after culturing. The application of molecular cytogenetic techniques such as fluorescence in situ hybridization (FISH), multicolor FISH, array comparative genome hybridization (aCGH), and single-nucleotide polymorphism (SNP) arrays may then be particularly valuable, alone or together with more exclusively molecular methods based on the polymerase chain reaction (PCR), and may improve significantly the rate at which genetic changes are found in hematological malignancies (5-12).
Not surprisingly, some chromosome aberrations and their corresponding fusion genes can be detected only with molecular methods. One of them is the t(12;21)(p13;q22)/ ETV6-RUNX1 which is one of the most common genetic rearrangements in pediatric B-lineage acute lymphoblastic leukemia (ALL) and defines a subgroup of patients with excellent prognosis (13, 14). Another example is the del(4)(q12q12)/FIP1L1-PDGFRA characteristic of hypereosinophilic syndrome. Patients with del(4)(q12q12)/FIP1L1-PDGFRA have an excellent prognosis when treated with imatinib (15-17).
Given the diagnostic, prognostic, biologic, and even therapeutic impact of leukemia-associated translocations and fusion genes, it is important to detect also cryptic genomic rearrangements that may be present in hematologic malignancies. High-throughput sequencing has been proven to be a powerful method for detecting fusion genes in cases with normal karyotype or with aberrations seemingly not involving the chromosome regions where the fusion gene partners map (18-20).
We here report an AML case carrying a t(9;12)(q34;q15) chromosomal translocation as the sole cytogenetic anomaly. Using RNA-sequencing, a cryptic DEK-NUP214 (formerly DEK-CAN) fusion gene as well as a PRRC2B-DEK fusion were found.
Materials and Methods
Ethics statement. The study was approved by the Regional Committee for Medical and Health Research Ethics, South-East Norway (REK Sør-Øst; http://helseforskning.etikkom.no) and written informed consent was obtained from the patient. The ethics committee's approval included a review of the consent procedure. All patient information has been anonymized.
Case report. A 20-year-old male was transferred to our institution with a preliminary diagnosis of AML. He had for two weeks experienced flu-like symptoms with general malaize and strikingly reduced physical stamina. A few days prior to hospitalization, he had also noticed stationary dark spots in his visual field.
Clinical examination was unremarkable. Of note, no gingival hyperplasia was found. There was significant anemia (6.9 g/dl (13.4-17.0)), thrombocytopenia (26×109/l (165-387)), and leukocytosis (46.3×109/l (3.6-9.3), monocytes 9.7×109/l (0.3-0.9)). Elevated LDH (724 U/l (<205)) and lysozyme (42 mg/l (5-15)) were also found. A blood smear disclosed numerous blasts and monocytosis. A bone marrow smear revealed a pleomorphic “blastoid” population with cells of variable size, some of which had irregular nuclei with many nucleoli and “dustlike” granules, whereas others had rounded nuclei and abundant blue-grey cytoplasm without granules. Some atypical monocytes and more mature granulocytes with atypical nucleus segmentation were also seen. The blasts displayed the immunophenotype CD34+MPO−CD64−/+CD38+CD33+CD13+HLA-DR+. A diagnosis of acute monoblastic leukemia was made.
Molecular genetic analyses were negative for RUNX1-RUNX1T1, CBFB-MYH11, MLLT-MLL, AFF1-MLL, and MLL-PTD fusion transcripts as well as for NPM1, but FLT3 mutation (TKD) was detected.
Complete hematologic remission was accomplished following induction treatment with daunorubicin and cytarabin. Subsequently, he received two cycles of high dose cytarabine and an allogeneic stem cell transplant from a matched unrelated donor following myeloablative conditioning. At follow up five years post transplantation, he was in complete remission with no signs of graft-versus-host disease (GVHD).
G-banding analysis. Bone marrow cells aspirated at diagnosis were cytogenetically investigated (21, 22). Chromosome preparations were made from metaphase cells of a 24-h culture, G-banded using Leishman stain, and karyotyped according to ISCN 2016 guidelines (23).
Fluorescence in situ hybridization (FISH). BAC clones were retrieved from the Human “32K” BAC Re-Array library (BACPAC Resources, https://bacpacresources.org/home.htm). They had been selected according to physical and genetic mapping data on chromosomes 6 and 9 (see below) as reported on the Human Genome Browser at the University of California, Santa Cruz website (May 2004, http://genome.ucsc.edu/). FISH mapping of the clones on normal controls was performed to confirm their chromosomal location. For the DEK locus on chromosome 6, the clones were CTD-2300B02 (Position: chr6:18199501-18330748; Band: 6p22.3; UCSC Genome Browser on Human May 2004 NCBI35/hg17 Assembly) and RP11-758O07 (Position: chr6:18301067-18524918; Band: 6p22.3); they were labelled red. For the NUP214 locus on chromosome 9, the clones were RP11-723C24 (chr9:130882132-131078602; Bands: 9q34.12 - 9q34.13), RP11-68C20 (chr9:131050288-131215735; Band: 9q34.13), and RP11-178K16 (Position: chr9:131131824-131308655; Band: 9q34.13); they were labelled green.
DNA was extracted and probes were labelled and hybridized according to Abbott Molecular recommendations (http://www.abbottmolecular.com/home.html). Chromosome preparations were counterstained with 0.2 μg/ml DAPI and overlaid with a 24×50 mm2 coverslip. Fluorescent signals were captured and analyzed using the CytoVision system (Leica Biosystems, Newcastle, UK).
RNA-sequencing. Three μg of total RNA extracted from the patient's bone marrow at the time of diagnosis were sent for high-throughput paired-end RNA-sequencing at the Norwegian Sequencing Centre, Ullevål Hospital (http://www.sequencing.uio.no/). Detailed information about the procedure was given previously (24). The software FusionCatcher was used to discover fusion transcripts (25) (https://github.com/ndaniel/fusioncatcher).
PCR analyses. The procedures of reverse transcriptase-Polymerase Chain Reaction (RT-PCR) and direct sequencing of the PCR products were previously described (20, 24). For the amplification of the DEK-NUP214 fusion transcript, two primer sets were used: 1) the forward DEK-1060F1 (CACCAAGAAGAATCAAAACAGTTCCA) together with the reverse NUP214-2767R1 (TGAAGACTATCCACCAGGTGATTCAG) and 2) the forward DEK-1060F1 together with NUP214-2709R1 (TGTTGGCTAGGGTGTTAAA CAGTGTC). For amplification of the PRRC2B-DEK fusion transcript, the forward primer PRRC2B-2072-F1 (AGGTGGATGATGATGCCTTCCTAC) together with the reverse primer DEK-1328-R1 (GGGAACGAGTCATCTTCTCTGTCC) were used.
Results
The G-banding analysis yielded the karyotype 45,X,-Y,t(9;12)(q34;q15)[16] (Figure 1).
Using the FusionCatcher software with the fastq files obtained from the Norwegian Sequencing Centre, 9 fusion genes were found (Table I), among them DEK-NUP214 and PRRC2B-DEK. We chose to focus exclusively on these two fusions partly because they were the only ones corresponding to an interchange of material between chromosome bands 9q34, known to be rearranged by chromosome analysis, and another genomic site, but also because DEK-NUP214 is a known leukemia-specific fusion gene.
PCR and direct sequencing verified the presence of both DEK-NUP214 and PRRC2B-DEK chimeric transcripts (Figure 2A-D). In the DEK-NUP214 transcript, exon 9 of DEK (nt 1240 in sequence with accession number NM_003472 version 3) was fused in frame to exon 18 of NUP214 (nt 2581 in NM_005085 version 3) (Figure 2A and B). In the PRRC2B-DEK transcript, exon 13 of PRRC2B (nt 2162 in sequence with accession number NM_013318 version 3) was fused out of frame to exon 10 of DEK (nt 1241 in NM_003472 version 3) (Figure 2C and D).
G-banding analysis of the bone marrow cells of the AML patient. Karyotype showing the chromosome aberration of leukemic cells: 45,X,-Y,t(9;12)(q34;q15). Arrows indicate breakpoints.
Fusion genes detected using FusionCatcher.
FISH on metaphase spreads with probes for DEK (Figure 3A and B; red signal) and NUP214 (Figure 3C and D; green signal) showed a red signal on one chromosome 6, two green signals, on the normal chromosome 9 and on the der(9), and a yellow fusion signal on the other chromosome 6, although both copies of chromosome 6 appeared cytogenetically normal by G-banding. Thus, FISH showed that the DEK-NUP214 fusion gene was located on the 6p22 band (Figure 3E).
Molecular genetic analysis of bone marrow cells from the AML patient. (A) Gel electrophoresis showing the amplified cDNA DEK-NUP214 fragments using two primer sets. Lane 1, amplification with the primers DEK-1060F1 and NUP214-2767R1. Lane 2, amplification with the primers DEK-1060F1 and NUP214-2709R1. M, 1 Kb DNA ladder (GeneRuler, ThermoFisher). (B) Partial sequence chromatogram of the amplified cDNA fragment showing the junction point of the DEK and NUP214 genes. (C) Gel electrophoresis showing the amplified cDNA PRRC2B-DEK fragment using the primers PRRC2B-2072-F1 and DEK-1328-R1 (lane 1). M, 1kb DNA ladder. (D) Partial sequence chromatogram of the amplified cDNA fragment showing the junction point of the PRRC2B and DEK genes.
Discussion
The present case of AML had a t(9;12)(q34;q15) as the sole aberration at cytogenetic analysis. This translocation was therefore assumed to be a primary leukemogenic rearrangement which might have led to generation of a pathogenetically-essential fusion gene, and we decided to perform RNA-sequencing to find it. We compared karyotyping and sequencing data looking specifically for suggested fusions corresponding to rearrangements between the chromosomal breakpoints, i.e., 9q34 and 12q15. However, none of the 9 fusion genes suggested by the RNA-sequencing data using FusionCather corresponded to the t(9;12)(q34;q15) (Table I). Instead, the analysis showed generation of DEK-NUP214 and PRRC2B-DEK fusion genes and revealed a submicroscopic cytogenetic aberration involving chromosome band 6p22 (where DEK maps) and 9q34 (where the NUP214 and PRRC2B genes map). Subsequently, the presence of both fusion transcripts was confirmed with RT-PCR/direct sequencing methodology. Further FISH investigation showed that both DEK-NUP214 and PRRC2B-DEK were generated by insertion of a fragment from 9q34 into the 6p22 band of a seemingly normal chromosome 6 (Figure 1). Since all three genes - DEK, NUP214, and PRRC2B - are transcribed from centromere to telomere, we conclude that the fragment from 9q34 was inverted and inserted into the DEK gene (Figure 3D).
Fluorescence in situ hybridization (FISH) of bone marrow cells from the AML patient. (A) Ideogram of chromosome 6 showing the mapping position of the DEK gene (vertical red line). (B) Diagram showing the FISH probe for DEK. Additional genes in this region are also shown. (C) Ideogram of chromosome 9 showing the mapping position of the NUP214 and PRCC2B genes (vertical green line). (D) Diagram showing the FISH probe for NUP214. Additional genes in this region are also shown. The region between NUP214 and PRCC2B genes which was inverted and inserted in chromosome 6 is marked as grey box. (E) FISH on metaphase with the DEK (red signal) and NUP214 (green signal) probes showing a red signal on chromosome 6, two green signals, one on normal chromosome 9 and one on der(9), and a yellow fusion signal on the second chromosome 6, which was seen as cytogenetically normal. The DEK-NUP214 fusion gene was located on the 6p22 band.
DEK-NUP214 is usually the result of a chromosomal translocation, t(6;9)(p22;q34). It encodes a 165 kDa protein (26, 27). The exact role of DEK-NUP214 in leukemogenesis is unknown, but the DEK-NUP214 protein was shown to increase protein synthesis in myeloid cells and the expression of DEK-NUP214 correlates with increased phosphorylation of the translation initiation protein, EIF4E (28). Studies of cell lines carrying a DEK-NUP214 fusion gene have revealed increased cellular proliferation presumably brought about by upregulation of mTOR (29). In addition, DEK-NUP214 induces leukemia in mice (30). The PRRC2B gene codes for a 2229 amino acid residue protein. Neither the expression of PRRC2B nor the function of its protein product is known (https://www.ncbi.nlm.nih.gov/gene/84726). The gene has no known role in leukemogenesis.
In the 2008 World Health Organization classification, AML with t(6;9)(p22;q34)/DEK-NUP214 is recognized as a distinct entity (31) corresponding to approximately 1% of all AMLs. Patients with t(6;9)(p22;q34)/DEK-NUP214 are often young adults (median age 35 years) or children (median age 13 years). The bone marrow shows distinctive morphologic features, there is a high frequency of FLT3 mutations, the disease is chemotherapy resistant, and the prognosis is very poor (31); however, hematopoietic stem cell transplantation improves the outcome in these patients (32-34). Thus, identification of t(6;9)(p22;q34) or the DEK-NUP214 fusion gene is crucial in choosing the right treatment. RNA-sequencing, as reported here, proved valuable for the detection of a DEK-NUP214 fusion in the leukemic cells whose only cytogenetic clue to being carriers of this leukemogenic change was that they showed rearrangement of chromosomal band 9q34.
Acknowledgements
The Authors thank Hege Kilen Andersen and Nina Øino for excellent technical assistance. This study was supported by grants from the Norwegian Radium Hospital Foundation.
Footnotes
This article is freely accessible online.
- Received September 7, 2017.
- Revision received October 6, 2017.
- Accepted October 12, 2017.
- Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved
